Incidental Mutation 'R1394:Cyp4a30b'
ID162732
Institutional Source Beutler Lab
Gene Symbol Cyp4a30b
Ensembl Gene ENSMUSG00000084346
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 30b
SynonymsCyp4a30b-ps, OTTMUSG00000008626
MMRRC Submission 039456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1394 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115452604-115471062 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 115470892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119958]
Predicted Effect probably null
Transcript: ENSMUST00000119958
SMART Domains Protein: ENSMUSP00000140857
Gene: ENSMUSG00000084346

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 52 503 1.4e-119 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A G 5: 113,101,496 Y122H probably damaging Het
Ankrd27 T C 7: 35,615,869 F481S possibly damaging Het
Casd1 T G 6: 4,624,117 C303W probably damaging Het
Cep128 C T 12: 91,266,980 R438Q probably benign Het
Cep192 A G 18: 67,858,921 T1957A probably damaging Het
Cep290 T C 10: 100,537,529 S1224P possibly damaging Het
Col5a2 A G 1: 45,403,419 probably null Het
Cwc22 G A 2: 77,929,479 R75C possibly damaging Het
Dnah11 T C 12: 117,972,364 D3298G possibly damaging Het
Drc3 T C 11: 60,393,719 I450T possibly damaging Het
Dst T C 1: 34,165,155 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fcgbp A G 7: 28,093,379 H936R probably damaging Het
Fkbp15 T A 4: 62,327,872 M440L probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gm44511 G A 6: 128,820,330 S32L possibly damaging Het
Gm597 T C 1: 28,776,809 E714G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Ift81 G T 5: 122,568,923 D485E probably benign Het
Ipp T A 4: 116,537,912 L548* probably null Het
Itm2a C T X: 107,398,201 V200I possibly damaging Het
Kank1 A G 19: 25,428,164 N1182S probably damaging Het
Mkks C T 2: 136,880,962 G92S probably damaging Het
Mybbp1a C T 11: 72,443,648 P243L probably damaging Het
Myo1f A G 17: 33,583,740 D386G probably damaging Het
Obsl1 T C 1: 75,492,665 S109G probably damaging Het
Olfr12 T A 1: 92,620,545 I213N probably benign Het
Olfr1347 T A 7: 6,488,362 T171S probably damaging Het
Pcdh12 A G 18: 38,281,189 probably null Het
Phlpp1 T C 1: 106,350,618 V920A possibly damaging Het
Phlpp2 T A 8: 109,877,030 C109* probably null Het
Prickle2 T A 6: 92,376,382 H701L possibly damaging Het
Psen1 G A 12: 83,724,572 G209R probably damaging Het
Psg19 T C 7: 18,797,058 N57S probably damaging Het
Rdh12 A G 12: 79,209,065 T9A probably benign Het
Rgma G T 7: 73,417,794 A360S probably benign Het
Scyl2 T A 10: 89,640,965 K766M possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata46 A G 1: 170,312,004 T191A probably benign Het
Spin1 T C 13: 51,144,481 Y179H probably damaging Het
Tecpr1 T C 5: 144,206,539 T673A possibly damaging Het
Tenm3 T A 8: 48,276,400 M1508L probably benign Het
Vasn C T 16: 4,649,712 R508* probably null Het
Vmn2r15 T A 5: 109,294,148 I140L probably benign Het
Wdr44 T G X: 23,796,059 C645G probably damaging Het
Zfand1 G T 3: 10,346,209 T62K probably benign Het
Zfy1 C T Y: 725,957 V603I possibly damaging Het
Other mutations in Cyp4a30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Cyp4a30b APN 4 115459019 missense probably damaging 1.00
IGL03233:Cyp4a30b APN 4 115458970 missense probably benign 0.08
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2873:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R3818:Cyp4a30b UTSW 4 115459009 missense probably damaging 1.00
R4052:Cyp4a30b UTSW 4 115454342 missense probably benign 0.00
R4684:Cyp4a30b UTSW 4 115455003 missense probably damaging 1.00
R5558:Cyp4a30b UTSW 4 115458866 missense probably damaging 1.00
R5997:Cyp4a30b UTSW 4 115459391 nonsense probably null
R6242:Cyp4a30b UTSW 4 115454390 missense possibly damaging 0.48
R6511:Cyp4a30b UTSW 4 115456708 missense probably damaging 1.00
R6759:Cyp4a30b UTSW 4 115461374 missense probably benign 0.02
R7285:Cyp4a30b UTSW 4 115456651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCCATGTGTCTGAGAGCAGAG -3'
(R):5'- AGCAGAAAGTTCTTCCAGCAGCAG -3'

Sequencing Primer
(F):5'- GGCTTTGTCAAAAATCAGGAGTCC -3'
(R):5'- CAGCAGGCTTCTGGAGATG -3'
Posted On2014-03-17