Incidental Mutation 'R1715:Ifna11'
ID190917
Institutional Source Beutler Lab
Gene Symbol Ifna11
Ensembl Gene ENSMUSG00000100549
Gene Nameinterferon alpha 11
SynonymsIFN-[a]11
MMRRC Submission 039748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R1715 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88819959-88820531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88820236 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 93 (S93L)
Ref Sequence ENSEMBL: ENSMUSP00000127921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105143] [ENSMUST00000170428]
Predicted Effect probably benign
Transcript: ENSMUST00000105143
SMART Domains Protein: ENSMUSP00000100774
Gene: ENSMUSG00000100713

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 2.32e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170428
AA Change: S93L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127921
Gene: ENSMUSG00000100549
AA Change: S93L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 5.54e-68 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,199,824 probably null Het
2210010C04Rik A G 6: 41,032,936 probably null Het
2410089E03Rik T A 15: 8,226,900 probably null Het
Abca8a G A 11: 110,091,580 T12M probably damaging Het
Alms1 T A 6: 85,629,052 Y2561* probably null Het
Atp10a G A 7: 58,786,505 V348I probably damaging Het
Best2 T C 8: 85,011,223 Y181C probably benign Het
Btaf1 T A 19: 36,969,121 D442E probably damaging Het
C330027C09Rik C T 16: 49,005,719 T383I probably benign Het
Carmil3 T G 14: 55,504,532 V1153G probably benign Het
Cc2d2a A G 5: 43,718,661 I993M probably damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cmtr2 T C 8: 110,222,798 L580P probably damaging Het
Col22a1 T C 15: 72,006,981 E109G possibly damaging Het
Crispld2 G T 8: 120,023,649 W264L possibly damaging Het
Cyp2c38 T C 19: 39,404,795 H276R probably benign Het
Dag1 A T 9: 108,208,715 V409E possibly damaging Het
Emc8 T C 8: 120,658,555 N146S probably benign Het
Glt8d1 T C 14: 31,011,521 V321A possibly damaging Het
Gm5174 C T 10: 86,656,912 noncoding transcript Het
Hdac10 G T 15: 89,126,709 probably null Het
Hectd4 A G 5: 121,344,818 D3144G possibly damaging Het
Il16 T C 7: 83,648,728 N431S probably benign Het
Irf8 A T 8: 120,754,388 E237V probably damaging Het
Lrp1b A G 2: 41,185,981 Y1769H probably damaging Het
Lrrc9 A G 12: 72,477,299 N761D probably damaging Het
Mbtps1 T C 8: 119,542,730 Y207C probably benign Het
Myo9a A G 9: 59,832,300 E765G probably damaging Het
Nlrp3 A G 11: 59,543,351 D80G probably damaging Het
Olfr361 G A 2: 37,085,176 P191S probably damaging Het
Olfr697 G C 7: 106,741,548 P129A probably damaging Het
Olfr830 A T 9: 18,875,794 I156F probably benign Het
Pcyt2 T A 11: 120,615,851 probably null Het
Plxnd1 T C 6: 115,968,681 T944A probably benign Het
Psd4 A T 2: 24,405,332 I833F probably damaging Het
Psmd7 A G 8: 107,581,185 I222T probably benign Het
Rap2b A G 3: 61,365,190 E45G probably damaging Het
Rbm22 T C 18: 60,560,844 S7P possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfx4 A G 10: 84,844,280 N107S probably damaging Het
Ripk2 T A 4: 16,155,192 probably null Het
Rpgrip1 T A 14: 52,140,691 C499S possibly damaging Het
Scarf1 T C 11: 75,524,044 S515P probably damaging Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sis T C 3: 72,889,010 I1813V possibly damaging Het
Slc17a3 A T 13: 23,856,741 T317S probably benign Het
Slc35e1 T C 8: 72,483,977 N340S probably benign Het
Smg6 A G 11: 74,929,430 I176V probably benign Het
Smim17 T C 7: 6,429,326 L89S probably damaging Het
Synm T C 7: 67,736,303 N95S probably damaging Het
Tdrd9 A G 12: 112,036,439 K841E possibly damaging Het
Tep1 G T 14: 50,854,567 F570L possibly damaging Het
Tgm3 G A 2: 130,026,814 probably null Het
Tra2b T C 16: 22,252,746 Y128C possibly damaging Het
Vmn2r17 T C 5: 109,428,244 V327A probably benign Het
Wdr20rt A T 12: 65,227,314 D344V probably damaging Het
Zfp940 A G 7: 29,844,938 C515R probably damaging Het
Other mutations in Ifna11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Ifna11 APN 4 88820077 missense probably benign 0.09
IGL03371:Ifna11 APN 4 88820175 missense probably benign 0.00
R0070:Ifna11 UTSW 4 88820275 missense possibly damaging 0.91
R2938:Ifna11 UTSW 4 88820293 missense probably damaging 1.00
R3113:Ifna11 UTSW 4 88819983 missense probably benign
R4788:Ifna11 UTSW 4 88820008 nonsense probably null
R4967:Ifna11 UTSW 4 88820050 missense probably null 0.11
R5038:Ifna11 UTSW 4 88820077 missense probably benign 0.09
R5412:Ifna11 UTSW 4 88820143 missense probably damaging 0.99
R6010:Ifna11 UTSW 4 88820041 missense probably benign 0.00
R6385:Ifna11 UTSW 4 88820149 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGAAGGTCCTGGCACAAATGAGG -3'
(R):5'- TTCCCAGCACATTGGCAGAGGAAG -3'

Sequencing Primer
(F):5'- AATGAGGAGGCTCACCCC -3'
(R):5'- TTCTCTCTCAGGAACACAGTG -3'
Posted On2014-05-14