Incidental Mutation 'R1574:Zfp949'
ID202735
Institutional Source Beutler Lab
Gene Symbol Zfp949
Ensembl Gene ENSMUSG00000032425
Gene Namezinc finger protein 949
Synonyms4930422I07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location88548020-88571061 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88569777 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 467 (K467*)
Ref Sequence ENSEMBL: ENSMUSP00000125325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160652] [ENSMUST00000161458] [ENSMUST00000162827]
Predicted Effect probably benign
Transcript: ENSMUST00000160652
Predicted Effect probably null
Transcript: ENSMUST00000161458
AA Change: K467*
SMART Domains Protein: ENSMUSP00000125017
Gene: ENSMUSG00000032425
AA Change: K467*

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162827
AA Change: K467*
SMART Domains Protein: ENSMUSP00000125325
Gene: ENSMUSG00000032425
AA Change: K467*

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162985
SMART Domains Protein: ENSMUSP00000124007
Gene: ENSMUSG00000032425

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis with defects in growth, development, cell proliferation, apoptosis and turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apeh A T 9: 108,092,726 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cdc25b T A 2: 131,191,137 probably benign Het
Cdon A G 9: 35,452,937 probably benign Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Ddx19a T C 8: 110,993,111 probably benign Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Gm1110 G T 9: 26,881,126 probably benign Het
Gm5499 T C 17: 87,078,995 noncoding transcript Het
Gmnc G T 16: 26,963,979 probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hc G A 2: 35,000,765 probably benign Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Lrmp T G 6: 145,158,630 probably benign Het
Mad2l2 G T 4: 148,142,972 probably benign Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Myh13 T C 11: 67,362,581 probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Prrxl1 A G 14: 32,605,324 probably benign Het
Qtrt2 A G 16: 43,871,832 probably benign Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Other mutations in Zfp949
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03201:Zfp949 APN 9 88568664 missense probably benign 0.23
R0034:Zfp949 UTSW 9 88567640 intron probably benign
R0462:Zfp949 UTSW 9 88568734 missense possibly damaging 0.63
R1457:Zfp949 UTSW 9 88569838 missense probably damaging 1.00
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1878:Zfp949 UTSW 9 88569303 missense probably damaging 0.99
R1917:Zfp949 UTSW 9 88570062 missense probably damaging 0.98
R4488:Zfp949 UTSW 9 88570089 missense probably damaging 0.98
R4839:Zfp949 UTSW 9 88569994 missense probably damaging 0.97
R5309:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5312:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5461:Zfp949 UTSW 9 88569484 missense probably benign 0.00
R6530:Zfp949 UTSW 9 88567287 critical splice donor site probably null
R6844:Zfp949 UTSW 9 88569411 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAAAACCTTTCCCAGTGAATTAGAC -3'
(R):5'- TCCCACATTTATTGCACTCATAGG -3'

Sequencing Primer
(F):5'- TGAGTGTGGTAAAGCCTTCCAAC -3'
(R):5'- ACTCATAGGGCTTTTCACCTGTG -3'
Posted On2014-06-23