Incidental Mutation 'R1899:Cpeb2'
ID214072
Institutional Source Beutler Lab
Gene Symbol Cpeb2
Ensembl Gene ENSMUSG00000039782
Gene Namecytoplasmic polyadenylation element binding protein 2
SynonymsA630055H10Rik
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43233170-43289724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43277587 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 600 (P600Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114066] [ENSMUST00000166713] [ENSMUST00000169035]
Predicted Effect probably damaging
Transcript: ENSMUST00000114065
AA Change: P600Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109699
Gene: ENSMUSG00000039782
AA Change: P600Q

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
RRM 265 337 1.5e-4 SMART
RRM 373 446 1.86e-2 SMART
PDB:2M13|A 447 512 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114066
AA Change: P211Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109700
Gene: ENSMUSG00000039782
AA Change: P211Q

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
low complexity region 222 232 N/A INTRINSIC
RRM 273 345 1.5e-4 SMART
RRM 381 454 1.86e-2 SMART
PDB:2M13|A 455 520 1e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000166713
AA Change: P774Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130921
Gene: ENSMUSG00000039782
AA Change: P774Q

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
RRM 758 830 1.5e-4 SMART
RRM 866 939 1.86e-2 SMART
PDB:2M13|A 940 1005 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000169035
AA Change: P744Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125857
Gene: ENSMUSG00000039782
AA Change: P744Q

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 56 79 N/A INTRINSIC
low complexity region 142 156 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
low complexity region 178 199 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 279 293 N/A INTRINSIC
low complexity region 342 369 N/A INTRINSIC
low complexity region 375 433 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 489 534 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
RRM 736 808 1.5e-4 SMART
RRM 844 917 1.86e-2 SMART
PDB:2M13|A 918 983 2e-6 PDB
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to cytoplasmic polyadenylation element binding protein (CPEB), an mRNA-binding protein that regulates cytoplasmic polyadenylation of mRNA as a trans factor in oogenesis and spermatogenesis. Studies of the similar gene in mice suggested a possible role of this protein in transcriptionally inactive haploid spermatids. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, decreased heart rate, and increased parasympathetic signaling leading to increased pulmonary acetylcholine level, bronchoconstriction, severe apnea, and abnormal breathing patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Cpeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Cpeb2 APN 5 43285831 missense probably damaging 0.98
IGL00771:Cpeb2 APN 5 43237547 missense possibly damaging 0.94
IGL00797:Cpeb2 APN 5 43281447 missense probably damaging 1.00
IGL01604:Cpeb2 APN 5 43278695 critical splice donor site probably null
IGL01632:Cpeb2 APN 5 43237422 missense probably benign 0.25
IGL03137:Cpeb2 APN 5 43261724 splice site probably benign
R0125:Cpeb2 UTSW 5 43238400 intron probably benign
R0200:Cpeb2 UTSW 5 43261776 missense possibly damaging 0.57
R0453:Cpeb2 UTSW 5 43285713 splice site probably benign
R1411:Cpeb2 UTSW 5 43233770 unclassified probably benign
R1542:Cpeb2 UTSW 5 43285875 missense probably damaging 1.00
R1563:Cpeb2 UTSW 5 43285737 missense probably damaging 1.00
R1573:Cpeb2 UTSW 5 43283930 splice site probably benign
R1703:Cpeb2 UTSW 5 43233838 unclassified probably benign
R1942:Cpeb2 UTSW 5 43235253 intron probably benign
R3429:Cpeb2 UTSW 5 43281230 critical splice donor site probably null
R3610:Cpeb2 UTSW 5 43285933 missense probably damaging 0.98
R3848:Cpeb2 UTSW 5 43237445 missense probably damaging 0.97
R4005:Cpeb2 UTSW 5 43238412 intron probably benign
R4306:Cpeb2 UTSW 5 43235235 intron probably benign
R4667:Cpeb2 UTSW 5 43233892 unclassified probably benign
R4754:Cpeb2 UTSW 5 43285857 missense possibly damaging 0.93
R4821:Cpeb2 UTSW 5 43233474 unclassified probably benign
R4906:Cpeb2 UTSW 5 43244662 missense possibly damaging 0.50
R5237:Cpeb2 UTSW 5 43285756 missense probably damaging 0.99
R6693:Cpeb2 UTSW 5 43285912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAACCCTTTGTTTGACATTAG -3'
(R):5'- ATGGATAGGACTAGAACATGTTTGTCC -3'

Sequencing Primer
(F):5'- AGTATGTTTCACTTAATCGGCATG -3'
(R):5'- CCTTCATATTTCAACAGCTC -3'
Posted On2014-07-14