Incidental Mutation 'R2112:Ralgps2'
ID232622
Institutional Source Beutler Lab
Gene Symbol Ralgps2
Ensembl Gene ENSMUSG00000026594
Gene NameRal GEF with PH domain and SH3 binding motif 2
Synonyms
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156804166-156939626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156832708 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 265 (Y265H)
Ref Sequence ENSEMBL: ENSMUSP00000139645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably damaging
Transcript: ENSMUST00000027886
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063199
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171292
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172057
AA Change: Y230H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594
AA Change: Y230H

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185198
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185970
Predicted Effect probably damaging
Transcript: ENSMUST00000188656
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189316
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189622
Predicted Effect probably damaging
Transcript: ENSMUST00000190648
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191503
Predicted Effect probably damaging
Transcript: ENSMUST00000191605
AA Change: Y265H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594
AA Change: Y265H

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Luc7l T C 17: 26,255,127 probably null Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Notch3 T A 17: 32,144,610 I1160F probably benign Het
Nox4 T C 7: 87,372,008 L476P probably damaging Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Tas1r2 G T 4: 139,655,355 M101I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Ralgps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02406:Ralgps2 APN 1 156828268 missense possibly damaging 0.49
IGL02669:Ralgps2 APN 1 156832698 missense probably damaging 1.00
IGL02898:Ralgps2 APN 1 156817744 missense probably benign 0.13
R0164:Ralgps2 UTSW 1 156887089 critical splice donor site probably null
R0164:Ralgps2 UTSW 1 156887089 critical splice donor site probably null
R0295:Ralgps2 UTSW 1 156823985 splice site probably benign
R0551:Ralgps2 UTSW 1 156832663 critical splice donor site probably null
R1179:Ralgps2 UTSW 1 156901799 missense probably damaging 1.00
R1573:Ralgps2 UTSW 1 156832930 missense possibly damaging 0.85
R4832:Ralgps2 UTSW 1 156857067 intron probably benign
R5316:Ralgps2 UTSW 1 156813497 missense probably damaging 0.99
R5762:Ralgps2 UTSW 1 156832664 critical splice donor site probably null
R6368:Ralgps2 UTSW 1 156884574 missense probably damaging 1.00
R6572:Ralgps2 UTSW 1 156824050 splice site probably null
R6777:Ralgps2 UTSW 1 156887945 critical splice donor site probably null
R7165:Ralgps2 UTSW 1 156828248 missense probably benign 0.05
X0020:Ralgps2 UTSW 1 156819892 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAGCTGGTACTGGTTCAGTTGTATC -3'
(R):5'- GCAGTCCTGTGAATATGGTGAG -3'

Sequencing Primer
(F):5'- GGTTCAGTTGTATCAGTGAGTAAAAG -3'
(R):5'- GTCCTGTGAATATGGTGAGTTAAAAG -3'
Posted On2014-09-18