Incidental Mutation 'R2258:Cntd1'
ID243561
Institutional Source Beutler Lab
Gene Symbol Cntd1
Ensembl Gene ENSMUSG00000078653
Gene Namecyclin N-terminal domain containing 1
Synonyms
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101279012-101296317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101284856 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 174 (S174P)
Ref Sequence ENSEMBL: ENSMUSP00000099396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041403] [ENSMUST00000103107] [ENSMUST00000130916] [ENSMUST00000167667] [ENSMUST00000172233]
Predicted Effect probably benign
Transcript: ENSMUST00000041403
Predicted Effect probably damaging
Transcript: ENSMUST00000103107
AA Change: S174P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099396
Gene: ENSMUSG00000078653
AA Change: S174P

DomainStartEndE-ValueType
Pfam:Cyclin_N 111 180 1.8e-6 PFAM
low complexity region 212 221 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128735
Predicted Effect probably benign
Transcript: ENSMUST00000130916
SMART Domains Protein: ENSMUSP00000119369
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:BH3 103 127 4.1e-20 PFAM
Pfam:APG6 133 444 1.1e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153438
Predicted Effect probably benign
Transcript: ENSMUST00000167667
Predicted Effect probably benign
Transcript: ENSMUST00000172233
SMART Domains Protein: ENSMUSP00000129156
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:APG6 79 274 3.7e-75 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Nwd2 C A 5: 63,805,156 N694K probably benign Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Tigd4 T A 3: 84,594,293 N172K probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Cntd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03309:Cntd1 APN 11 101284764 missense probably damaging 0.98
R0328:Cntd1 UTSW 11 101283433 missense probably benign 0.10
R0669:Cntd1 UTSW 11 101287498 missense probably damaging 1.00
R1344:Cntd1 UTSW 11 101285740 missense possibly damaging 0.78
R1418:Cntd1 UTSW 11 101285740 missense possibly damaging 0.78
R1928:Cntd1 UTSW 11 101283852 missense probably damaging 1.00
R3928:Cntd1 UTSW 11 101287519 missense probably benign 0.00
R5001:Cntd1 UTSW 11 101285731 missense possibly damaging 0.53
R6389:Cntd1 UTSW 11 101285751 missense probably damaging 0.96
R7058:Cntd1 UTSW 11 101287426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAACTTAGTGGGCTTGGAG -3'
(R):5'- TCATCCAGAAACACGGGCTC -3'

Sequencing Primer
(F):5'- TTGCTGTGAGGGAGGGCATAC -3'
(R):5'- GAAACACGGGCTCCCTTC -3'
Posted On2014-10-16