Incidental Mutation 'R2258:Ttyh1'
ID243531
Institutional Source Beutler Lab
Gene Symbol Ttyh1
Ensembl Gene ENSMUSG00000030428
Gene Nametweety family member 1
Synonyms6330408P11Rik, tty, 4930459B04Rik
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4119408-4136708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4128184 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000120182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032594] [ENSMUST00000079415] [ENSMUST00000119661] [ENSMUST00000129423] [ENSMUST00000153673] [ENSMUST00000206869] [ENSMUST00000206987]
Predicted Effect probably benign
Transcript: ENSMUST00000032594
SMART Domains Protein: ENSMUSP00000032594
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 1 72 4.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079415
AA Change: V218A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078384
Gene: ENSMUSG00000030428
AA Change: V218A

DomainStartEndE-ValueType
Pfam:Tweety 26 428 3.2e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119661
AA Change: V218A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113937
Gene: ENSMUSG00000030428
AA Change: V218A

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128317
Predicted Effect probably damaging
Transcript: ENSMUST00000129423
AA Change: V218A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120182
Gene: ENSMUSG00000030428
AA Change: V218A

DomainStartEndE-ValueType
Pfam:Tweety 26 435 1.9e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151959
Predicted Effect probably benign
Transcript: ENSMUST00000153673
SMART Domains Protein: ENSMUSP00000115623
Gene: ENSMUSG00000030428

DomainStartEndE-ValueType
Pfam:Tweety 26 103 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205971
Predicted Effect possibly damaging
Transcript: ENSMUST00000206869
AA Change: V122A

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000206987
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Tweety family of membrane proteins. Members of this family contain five predicted transmembrane regions that are arranged in a characteristic pattern. In mouse, the protein is predominantly localized to the endoplasmic reticulum and displays calcium binding activity. Targeted knock out of this gene results in early embryonic lethality prior to the blastocyst stage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with arrest before the blastocyst stage and mitotic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Cntd1 T C 11: 101,284,856 S174P probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Nwd2 C A 5: 63,805,156 N694K probably benign Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Tigd4 T A 3: 84,594,293 N172K probably benign Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Ttyh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ttyh1 APN 7 4124657 missense probably damaging 1.00
IGL01730:Ttyh1 APN 7 4125721 missense possibly damaging 0.90
IGL02052:Ttyh1 APN 7 4130574 unclassified probably benign
IGL02410:Ttyh1 APN 7 4133899 utr 3 prime probably benign
IGL02651:Ttyh1 APN 7 4124679 missense probably damaging 1.00
PIT4468001:Ttyh1 UTSW 7 4119772 missense possibly damaging 0.49
R0137:Ttyh1 UTSW 7 4124720 missense possibly damaging 0.95
R1699:Ttyh1 UTSW 7 4119696 missense possibly damaging 0.79
R1739:Ttyh1 UTSW 7 4129349 missense probably benign 0.18
R1865:Ttyh1 UTSW 7 4119731 missense probably damaging 1.00
R2259:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R2260:Ttyh1 UTSW 7 4128184 missense probably damaging 0.98
R3027:Ttyh1 UTSW 7 4119722 missense probably benign 0.31
R3426:Ttyh1 UTSW 7 4133219 critical splice donor site probably null
R3939:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R3941:Ttyh1 UTSW 7 4129318 missense probably damaging 0.97
R4328:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4329:Ttyh1 UTSW 7 4130581 missense probably damaging 0.99
R4527:Ttyh1 UTSW 7 4119764 missense probably damaging 1.00
R4849:Ttyh1 UTSW 7 4122534 missense possibly damaging 0.84
R4898:Ttyh1 UTSW 7 4133736 missense probably benign 0.03
R4931:Ttyh1 UTSW 7 4133944 utr 3 prime probably benign
R4960:Ttyh1 UTSW 7 4128226 missense probably damaging 1.00
R6158:Ttyh1 UTSW 7 4125562 missense probably benign 0.00
R6362:Ttyh1 UTSW 7 4129324 missense possibly damaging 0.67
R6799:Ttyh1 UTSW 7 4133222 splice site probably null
R6823:Ttyh1 UTSW 7 4122529 missense probably damaging 0.97
R6897:Ttyh1 UTSW 7 4124650 utr 3 prime probably benign
R7070:Ttyh1 UTSW 7 4133364 missense probably damaging 0.99
R7236:Ttyh1 UTSW 7 4133664 missense probably benign 0.00
R7287:Ttyh1 UTSW 7 4125658 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGTGCTTCAGTTCCACAC -3'
(R):5'- ACGTGTGGCATGTCAGAGAC -3'

Sequencing Primer
(F):5'- GTTCCACACCCATGCTGCAG -3'
(R):5'- TCCCGAGCCCTTTATAGCAAATG -3'
Posted On2014-10-16