Incidental Mutation 'R2306:Mme'
ID244582
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission 040305-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2306 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63300252 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 40 (I40V)
Ref Sequence ENSEMBL: ENSMUSP00000141469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000191633] [ENSMUST00000192002] [ENSMUST00000194134] [ENSMUST00000194150] [ENSMUST00000194324] [ENSMUST00000194836]
Predicted Effect probably benign
Transcript: ENSMUST00000029400
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191633
AA Change: I40V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141469
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 14 130 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192002
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141483
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 178 1.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193805
Predicted Effect probably benign
Transcript: ENSMUST00000194134
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194150
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194324
AA Change: I40V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142259
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-8 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 131 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194836
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141452
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 187 5.6e-33 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 G A 17: 42,713,119 H154Y possibly damaging Het
Arhgef7 T A 8: 11,812,680 Y501* probably null Het
Atmin T C 8: 116,957,650 F683S probably benign Het
Bcat1 A G 6: 145,007,653 V403A probably damaging Het
C4b T G 17: 34,728,518 M1729L probably benign Het
Cdh23 A G 10: 60,323,445 S2185P probably damaging Het
Crispld2 T G 8: 120,026,071 V286G probably damaging Het
Ctsw T C 19: 5,466,982 probably null Het
Dnaic1 T C 4: 41,625,239 V401A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Ifitm2 T A 7: 140,955,789 T43S probably damaging Het
Mark1 A T 1: 184,900,861 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfatc2 A C 2: 168,590,103 F30C probably damaging Het
Npr2 T A 4: 43,633,609 V251D probably damaging Het
Pax8 T A 2: 24,443,045 Y96F probably damaging Het
Ppp1r13b T C 12: 111,844,893 E187G probably damaging Het
Rbp3 A T 14: 33,962,563 D1183V probably damaging Het
Reln T G 5: 21,896,786 D3382A probably damaging Het
Rfc3 A G 5: 151,643,778 L271P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdk1 C T 5: 141,962,700 A600V probably benign Het
Sfr1 T C 19: 47,734,852 I265T probably damaging Het
Syt13 G A 2: 92,940,967 R133H probably benign Het
Tmem231 A T 8: 111,918,871 V132D probably damaging Het
Tmem247 C A 17: 86,918,441 A103E probably benign Het
Unc119b A T 5: 115,125,475 Y223* probably null Het
Vmn1r196 T A 13: 22,293,303 F37L probably benign Het
Vps13c T A 9: 67,987,993 Y3627N probably damaging Het
Zfp292 C A 4: 34,809,468 S1192I probably damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACCAATCAGATTCAGATG -3'
(R):5'- CTTTAACATATGGATGCGGATCTTC -3'

Sequencing Primer
(F):5'- CACAGATGTGCTTTTTATGAAATGC -3'
(R):5'- GGATGCGGATCTTCTAAATGAATCC -3'
Posted On2014-10-30