Incidental Mutation 'R2306:Mme'
ID 244582
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Name membrane metallo endopeptidase
Synonyms neprilysin, 6030454K05Rik, neutral endopeptidase, NEP, CD10
MMRRC Submission 040305-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2306 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 63202632-63291134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63207673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 40 (I40V)
Ref Sequence ENSEMBL: ENSMUSP00000141469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000191633] [ENSMUST00000192002] [ENSMUST00000194134] [ENSMUST00000194150] [ENSMUST00000194324] [ENSMUST00000194836]
AlphaFold Q61391
Predicted Effect probably benign
Transcript: ENSMUST00000029400
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191633
AA Change: I40V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141469
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 14 130 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192002
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141483
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 178 1.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193805
Predicted Effect probably benign
Transcript: ENSMUST00000194134
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194150
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194324
AA Change: I40V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142259
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-8 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 131 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194836
AA Change: I40V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141452
Gene: ENSMUSG00000027820
AA Change: I40V

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 187 5.6e-33 PFAM
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.4%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 G A 17: 43,024,010 (GRCm39) H154Y possibly damaging Het
Arhgef7 T A 8: 11,862,680 (GRCm39) Y501* probably null Het
Atmin T C 8: 117,684,389 (GRCm39) F683S probably benign Het
Bcat1 A G 6: 144,953,379 (GRCm39) V403A probably damaging Het
C4b T G 17: 34,947,492 (GRCm39) M1729L probably benign Het
Cdh23 A G 10: 60,159,224 (GRCm39) S2185P probably damaging Het
Crispld2 T G 8: 120,752,810 (GRCm39) V286G probably damaging Het
Ctsw T C 19: 5,517,010 (GRCm39) probably null Het
Dnai1 T C 4: 41,625,239 (GRCm39) V401A probably benign Het
Gm10801 G C 2: 98,494,352 (GRCm39) R143T possibly damaging Het
Ifitm2 T A 7: 140,535,702 (GRCm39) T43S probably damaging Het
Mark1 A T 1: 184,633,058 (GRCm39) probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Nfatc2 A C 2: 168,432,023 (GRCm39) F30C probably damaging Het
Npr2 T A 4: 43,633,609 (GRCm39) V251D probably damaging Het
Pax8 T A 2: 24,333,057 (GRCm39) Y96F probably damaging Het
Ppp1r13b T C 12: 111,811,327 (GRCm39) E187G probably damaging Het
Rbp3 A T 14: 33,684,520 (GRCm39) D1183V probably damaging Het
Reln T G 5: 22,101,784 (GRCm39) D3382A probably damaging Het
Rfc3 A G 5: 151,567,243 (GRCm39) L271P probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sdk1 C T 5: 141,948,455 (GRCm39) A600V probably benign Het
Sfr1 T C 19: 47,723,291 (GRCm39) I265T probably damaging Het
Syt13 G A 2: 92,771,312 (GRCm39) R133H probably benign Het
Tmem231 A T 8: 112,645,503 (GRCm39) V132D probably damaging Het
Tmem247 C A 17: 87,225,869 (GRCm39) A103E probably benign Het
Unc119b A T 5: 115,263,534 (GRCm39) Y223* probably null Het
Vmn1r196 T A 13: 22,477,473 (GRCm39) F37L probably benign Het
Vps13c T A 9: 67,895,275 (GRCm39) Y3627N probably damaging Het
Zfp292 C A 4: 34,809,468 (GRCm39) S1192I probably damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63,247,465 (GRCm39) missense possibly damaging 0.95
IGL00329:Mme APN 3 63,287,749 (GRCm39) nonsense probably null
IGL01013:Mme APN 3 63,235,281 (GRCm39) splice site probably null
IGL01316:Mme APN 3 63,247,580 (GRCm39) splice site probably benign
IGL01333:Mme APN 3 63,253,512 (GRCm39) missense probably damaging 1.00
IGL01392:Mme APN 3 63,269,467 (GRCm39) missense probably damaging 1.00
IGL01566:Mme APN 3 63,269,350 (GRCm39) splice site probably benign
IGL01739:Mme APN 3 63,247,534 (GRCm39) missense possibly damaging 0.78
IGL01996:Mme APN 3 63,250,970 (GRCm39) missense probably benign 0.11
IGL02125:Mme APN 3 63,256,070 (GRCm39) missense probably damaging 1.00
IGL02154:Mme APN 3 63,250,976 (GRCm39) missense probably benign
IGL03214:Mme APN 3 63,237,111 (GRCm39) missense possibly damaging 0.72
IGL03291:Mme APN 3 63,253,525 (GRCm39) missense probably benign 0.00
R0498:Mme UTSW 3 63,253,487 (GRCm39) missense probably damaging 1.00
R0595:Mme UTSW 3 63,235,602 (GRCm39) missense probably benign 0.27
R0980:Mme UTSW 3 63,247,550 (GRCm39) missense probably benign
R1210:Mme UTSW 3 63,251,027 (GRCm39) missense probably benign 0.01
R1600:Mme UTSW 3 63,272,479 (GRCm39) missense probably damaging 1.00
R1852:Mme UTSW 3 63,235,467 (GRCm39) missense probably benign 0.00
R1852:Mme UTSW 3 63,235,404 (GRCm39) missense probably benign 0.31
R2037:Mme UTSW 3 63,235,681 (GRCm39) missense probably null 1.00
R2177:Mme UTSW 3 63,208,426 (GRCm39) missense probably benign 0.02
R2200:Mme UTSW 3 63,287,713 (GRCm39) missense possibly damaging 0.87
R2847:Mme UTSW 3 63,252,620 (GRCm39) missense possibly damaging 0.91
R3008:Mme UTSW 3 63,266,378 (GRCm39) missense probably damaging 1.00
R3749:Mme UTSW 3 63,250,961 (GRCm39) missense probably damaging 1.00
R3876:Mme UTSW 3 63,269,480 (GRCm39) splice site probably benign
R3961:Mme UTSW 3 63,252,613 (GRCm39) missense probably damaging 1.00
R3981:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R3982:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R3983:Mme UTSW 3 63,235,485 (GRCm39) missense probably damaging 1.00
R4494:Mme UTSW 3 63,254,613 (GRCm39) missense probably benign
R4589:Mme UTSW 3 63,287,693 (GRCm39) missense probably benign
R4706:Mme UTSW 3 63,256,133 (GRCm39) missense possibly damaging 0.92
R4871:Mme UTSW 3 63,247,453 (GRCm39) missense probably benign 0.01
R4957:Mme UTSW 3 63,250,910 (GRCm39) splice site probably benign
R5053:Mme UTSW 3 63,272,270 (GRCm39) missense probably damaging 1.00
R5316:Mme UTSW 3 63,276,375 (GRCm39) missense probably damaging 1.00
R5502:Mme UTSW 3 63,207,702 (GRCm39) nonsense probably null
R5579:Mme UTSW 3 63,256,066 (GRCm39) missense probably damaging 1.00
R6007:Mme UTSW 3 63,250,929 (GRCm39) nonsense probably null
R6022:Mme UTSW 3 63,272,218 (GRCm39) missense probably damaging 1.00
R6143:Mme UTSW 3 63,207,532 (GRCm39) splice site probably null
R6154:Mme UTSW 3 63,207,674 (GRCm39) missense probably damaging 0.98
R6333:Mme UTSW 3 63,249,382 (GRCm39) missense probably benign 0.00
R6476:Mme UTSW 3 63,251,056 (GRCm39) critical splice donor site probably null
R6514:Mme UTSW 3 63,272,265 (GRCm39) nonsense probably null
R6711:Mme UTSW 3 63,249,339 (GRCm39) missense possibly damaging 0.93
R6842:Mme UTSW 3 63,269,465 (GRCm39) missense probably damaging 1.00
R6996:Mme UTSW 3 63,253,523 (GRCm39) missense possibly damaging 0.63
R7040:Mme UTSW 3 63,276,344 (GRCm39) missense probably damaging 1.00
R7043:Mme UTSW 3 63,252,638 (GRCm39) nonsense probably null
R7084:Mme UTSW 3 63,235,638 (GRCm39) missense probably damaging 0.98
R7126:Mme UTSW 3 63,276,322 (GRCm39) missense probably damaging 0.97
R7783:Mme UTSW 3 63,272,288 (GRCm39) missense probably damaging 1.00
R8501:Mme UTSW 3 63,234,156 (GRCm39) missense probably damaging 1.00
R8857:Mme UTSW 3 63,256,070 (GRCm39) missense probably damaging 1.00
R9453:Mme UTSW 3 63,272,306 (GRCm39) missense possibly damaging 0.90
R9556:Mme UTSW 3 63,272,225 (GRCm39) missense probably damaging 0.97
R9648:Mme UTSW 3 63,208,426 (GRCm39) missense probably benign 0.02
X0058:Mme UTSW 3 63,272,442 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACCAATCAGATTCAGATG -3'
(R):5'- CTTTAACATATGGATGCGGATCTTC -3'

Sequencing Primer
(F):5'- CACAGATGTGCTTTTTATGAAATGC -3'
(R):5'- GGATGCGGATCTTCTAAATGAATCC -3'
Posted On 2014-10-30