Mutagenetix > Incidental Mutation

Incidental Mutation 'R2320:Trim17'

245615

Institutional Source

Beutler Lab

Gene Symbol

Trim17

Ensembl Gene

ENSMUSG00000036964

Gene Name

tripartite motif-containing 17

Synonyms

Rnf16, terf

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2320 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58845511-58863923 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58857624 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 152 (Y152H)

Ref Sequence

ENSEMBL: ENSMUSP00000074639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]

AlphaFold

Q7TPM3

Predicted Effect

probably benign
Transcript: ENSMUST00000047697
AA Change: Y152H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964
AA Change: Y152H

Domain	Start	End	E-Value	Type
RING	16	65	1.17e-10	SMART
BBOX	94	135	4.1e-15	SMART
coiled coil region	143	180	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075141
AA Change: Y152H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: Y152H

Domain	Start	End	E-Value	Type
RING	16	65	1.17e-10	SMART
BBOX	94	135	4.1e-15	SMART
coiled coil region	143	180	N/A	INTRINSIC
PRY	294	347	8.95e-16	SMART
SPRY	348	472	2.54e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131221

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc10	T	C	8: 80,501,708 (GRCm39)	Y159H	probably benign	Het
Arid1a	A	T	4: 133,407,840 (GRCm39)	N2222K	unknown	Het
Cpxm1	A	G	2: 130,236,131 (GRCm39)	Y344H	probably damaging	Het
Itpr3	T	C	17: 27,314,889 (GRCm39)	S679P	probably benign	Het
Macf1	T	C	4: 123,333,288 (GRCm39)	T2376A	probably benign	Het
Med4	T	A	14: 73,755,373 (GRCm39)	M227K	possibly damaging	Het
Ncan	T	C	8: 70,560,868 (GRCm39)	I700V	probably benign	Het
Or1j15	T	A	2: 36,458,637 (GRCm39)	V9E	possibly damaging	Het
Pik3c2b	A	T	1: 133,031,151 (GRCm39)	S1486C	probably damaging	Het
Ralbp1	A	G	17: 66,159,742 (GRCm39)	I507T	possibly damaging	Het
Rpl4	C	T	9: 64,082,881 (GRCm39)	R100C	probably damaging	Het
Scn5a	C	A	9: 119,359,022 (GRCm39)		probably null	Het
Serhl	A	G	15: 82,986,073 (GRCm39)	D2G	probably damaging	Het
Thbd	T	C	2: 148,248,566 (GRCm39)	E434G	probably damaging	Het
Vmn1r38	G	A	6: 66,753,534 (GRCm39)	T194I	possibly damaging	Het
Wdhd1	C	T	14: 47,511,485 (GRCm39)	V76I	probably benign	Het
Zfp709	T	A	8: 72,641,136 (GRCm39)	V11E	probably damaging	Het

Other mutations in Trim17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01524:Trim17	APN	11	58,861,423 (GRCm39)	missense	probably damaging	1.00
IGL02581:Trim17	APN	11	58,861,902 (GRCm39)	nonsense	probably null
P0026:Trim17	UTSW	11	58,862,084 (GRCm39)	missense	possibly damaging	0.83
R0518:Trim17	UTSW	11	58,859,320 (GRCm39)	missense	probably damaging	0.99
R0521:Trim17	UTSW	11	58,859,320 (GRCm39)	missense	probably damaging	0.99
R0765:Trim17	UTSW	11	58,862,195 (GRCm39)	missense	possibly damaging	0.73
R1165:Trim17	UTSW	11	58,862,041 (GRCm39)	missense	possibly damaging	0.92
R1441:Trim17	UTSW	11	58,856,018 (GRCm39)	missense	probably damaging	1.00
R2164:Trim17	UTSW	11	58,862,237 (GRCm39)	missense	probably damaging	1.00
R3436:Trim17	UTSW	11	58,856,059 (GRCm39)	missense	probably damaging	1.00
R4715:Trim17	UTSW	11	58,859,276 (GRCm39)	intron	probably benign
R4832:Trim17	UTSW	11	58,862,270 (GRCm39)	missense	probably damaging	0.97
R4928:Trim17	UTSW	11	58,845,127 (GRCm39)	unclassified	probably benign
R4950:Trim17	UTSW	11	58,861,254 (GRCm39)	missense	probably damaging	0.98
R5339:Trim17	UTSW	11	58,845,336 (GRCm39)	splice site	probably null
R5909:Trim17	UTSW	11	58,859,506 (GRCm39)	missense	probably damaging	1.00
R5915:Trim17	UTSW	11	58,859,388 (GRCm39)	missense	probably damaging	0.99
R5947:Trim17	UTSW	11	58,856,369 (GRCm39)	missense	probably damaging	1.00
R6732:Trim17	UTSW	11	58,861,851 (GRCm39)	critical splice acceptor site	probably null
R7027:Trim17	UTSW	11	58,859,442 (GRCm39)	missense	probably benign	0.08
R7143:Trim17	UTSW	11	58,856,010 (GRCm39)	nonsense	probably null
R7168:Trim17	UTSW	11	58,859,404 (GRCm39)	missense	probably benign
R7682:Trim17	UTSW	11	58,857,634 (GRCm39)	missense	possibly damaging	0.82
R7707:Trim17	UTSW	11	58,856,110 (GRCm39)	nonsense	probably null
R7972:Trim17	UTSW	11	58,859,394 (GRCm39)	missense	probably benign	0.01
R8543:Trim17	UTSW	11	58,862,281 (GRCm39)	missense	probably damaging	1.00
R8791:Trim17	UTSW	11	58,862,002 (GRCm39)	missense	probably benign	0.00
R8894:Trim17	UTSW	11	58,859,536 (GRCm39)	missense	probably benign	0.00
R9015:Trim17	UTSW	11	58,856,057 (GRCm39)	missense	probably damaging	0.99
R9026:Trim17	UTSW	11	58,862,273 (GRCm39)	missense	probably benign	0.01
R9269:Trim17	UTSW	11	58,862,257 (GRCm39)	missense	probably damaging	1.00
R9609:Trim17	UTSW	11	58,855,964 (GRCm39)	missense	probably damaging	1.00
Z1177:Trim17	UTSW	11	58,856,215 (GRCm39)	missense	probably damaging	0.99
Z1186:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1186:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00
Z1187:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1187:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00
Z1188:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1188:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00
Z1189:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1189:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00
Z1190:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1190:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00
Z1191:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1191:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00
Z1192:Trim17	UTSW	11	58,861,272 (GRCm39)	missense	probably benign
Z1192:Trim17	UTSW	11	58,856,331 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCAAAGCCCAGGTCAAGAG -3'
(R):5'- GCTCAATTTGTAGGTCAGGCAC -3'

Sequencing Primer
(F):5'- CAGGTCAAGAGAGGCTCATTTCC -3'
(R):5'- TGCAGAGTACAGGAACCCTTTTC -3'

Posted On

2014-10-30