Incidental Mutation 'R2383:Or2f1b'
ID 247603
Institutional Source Beutler Lab
Gene Symbol Or2f1b
Ensembl Gene ENSMUSG00000095236
Gene Name olfactory receptor family 2 subfamily F member 1B
Synonyms 18A, GA_x6K02T2P3E9-4797841-4796888, Olfr38, MOR257-2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R2383 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42738988-42739941 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42739393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 136 (M136L)
Ref Sequence ENSEMBL: ENSMUSP00000149726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074499] [ENSMUST00000215796]
AlphaFold Q8VGP4
Predicted Effect probably benign
Transcript: ENSMUST00000074499
AA Change: M136L

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093654
Gene: ENSMUSG00000095236
AA Change: M136L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-52 PFAM
Pfam:7tm_1 41 290 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215796
AA Change: M136L

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 130,893,282 (GRCm39) T748A probably benign Het
Afg3l2 A G 18: 67,556,026 (GRCm39) V435A possibly damaging Het
Ccdc170 G A 10: 4,484,208 (GRCm39) E345K probably benign Het
Chd2 T C 7: 73,153,168 (GRCm39) I227V possibly damaging Het
Cndp2 C A 18: 84,693,215 (GRCm39) D182Y possibly damaging Het
Col14a1 A T 15: 55,310,913 (GRCm39) probably benign Het
Cyp2e1 C T 7: 140,349,981 (GRCm39) S222L probably benign Het
Evx2 T C 2: 74,488,393 (GRCm39) probably null Het
Kics2 A G 10: 121,586,554 (GRCm39) T290A possibly damaging Het
L1td1 A G 4: 98,625,959 (GRCm39) E718G possibly damaging Het
Lgr4 T C 2: 109,830,960 (GRCm39) S296P probably damaging Het
Lrrc7 T C 3: 157,869,593 (GRCm39) M709V probably benign Het
Mtbp G A 15: 55,429,590 (GRCm39) G162D probably damaging Het
Nap1l1 T G 10: 111,329,272 (GRCm39) D295E probably damaging Het
Plrg1 C T 3: 82,973,255 (GRCm39) P178S probably damaging Het
Serpina1b T A 12: 103,694,539 (GRCm39) I402F probably benign Het
Sla T A 15: 66,654,525 (GRCm39) I254F probably damaging Het
Slc25a29 A G 12: 108,792,934 (GRCm39) S215P probably damaging Het
Thoc2l T C 5: 104,666,854 (GRCm39) S459P probably benign Het
Tiam1 A G 16: 89,595,572 (GRCm39) V1303A probably benign Het
Trim45 A T 3: 100,832,543 (GRCm39) I259F probably damaging Het
Ttn T C 2: 76,536,856 (GRCm39) S34990G probably benign Het
Zbtb48 A G 4: 152,111,407 (GRCm39) V36A probably damaging Het
Other mutations in Or2f1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Or2f1b APN 6 42,739,046 (GRCm39) missense probably damaging 0.99
IGL01567:Or2f1b APN 6 42,739,661 (GRCm39) missense probably benign 0.07
IGL02097:Or2f1b APN 6 42,739,394 (GRCm39) missense probably damaging 0.98
IGL02186:Or2f1b APN 6 42,739,880 (GRCm39) missense probably null 0.96
IGL02473:Or2f1b APN 6 42,739,640 (GRCm39) missense probably damaging 1.00
R0541:Or2f1b UTSW 6 42,739,154 (GRCm39) missense probably damaging 1.00
R1210:Or2f1b UTSW 6 42,739,601 (GRCm39) missense possibly damaging 0.79
R1368:Or2f1b UTSW 6 42,739,613 (GRCm39) missense possibly damaging 0.91
R4614:Or2f1b UTSW 6 42,739,352 (GRCm39) missense probably benign 0.07
R4616:Or2f1b UTSW 6 42,739,352 (GRCm39) missense probably benign 0.07
R4844:Or2f1b UTSW 6 42,739,394 (GRCm39) missense probably damaging 0.98
R5121:Or2f1b UTSW 6 42,739,931 (GRCm39) nonsense probably null
R5951:Or2f1b UTSW 6 42,739,493 (GRCm39) missense probably damaging 1.00
R6061:Or2f1b UTSW 6 42,739,899 (GRCm39) missense probably damaging 0.99
R6336:Or2f1b UTSW 6 42,739,591 (GRCm39) missense probably damaging 1.00
R7414:Or2f1b UTSW 6 42,739,762 (GRCm39) missense probably damaging 1.00
R8344:Or2f1b UTSW 6 42,739,499 (GRCm39) missense probably benign 0.03
R9603:Or2f1b UTSW 6 42,739,672 (GRCm39) nonsense probably null
X0018:Or2f1b UTSW 6 42,739,869 (GRCm39) missense probably damaging 0.99
Z1177:Or2f1b UTSW 6 42,739,141 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGGTGGATGCATCTTATG -3'
(R):5'- GACAATGCTAGAAACCATGATTGC -3'

Sequencing Primer
(F):5'- AAGCATAGTCCCCCAGCTG -3'
(R):5'- GCAATCTTGTTAGATGAGGTATCCAC -3'
Posted On 2014-11-11