Incidental Mutation 'R2385:Arpc1a'
ID 247674
Institutional Source Beutler Lab
Gene Symbol Arpc1a
Ensembl Gene ENSMUSG00000029621
Gene Name actin related protein 2/3 complex, subunit 1A
Synonyms Sid32, 1110030K07Rik, 0610010H08Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R2385 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 145020679-145045566 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 145041333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031625] [ENSMUST00000127694]
AlphaFold Q9R0Q6
Predicted Effect probably null
Transcript: ENSMUST00000031625
SMART Domains Protein: ENSMUSP00000031625
Gene: ENSMUSG00000029621

DomainStartEndE-ValueType
Blast:WD40 1 36 1e-18 BLAST
WD40 41 80 2.55e-6 SMART
WD40 89 124 1.1e2 SMART
WD40 134 170 1.46e-1 SMART
WD40 191 232 4.62e-1 SMART
WD40 235 273 9.51e1 SMART
WD40 312 356 3.68e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127694
SMART Domains Protein: ENSMUSP00000143026
Gene: ENSMUSG00000029621

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-18 BLAST
WD40 41 80 1.6e-8 SMART
WD40 89 124 6.8e-1 SMART
WD40 134 170 8.9e-4 SMART
WD40 191 232 2.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142276
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,732,749 (GRCm39) T106A probably damaging Het
Adgra3 A T 5: 50,136,908 (GRCm39) I595N possibly damaging Het
Aox3 A G 1: 58,177,448 (GRCm39) E221G probably damaging Het
Cd180 A G 13: 102,841,691 (GRCm39) T246A probably benign Het
Cep250 A G 2: 155,816,261 (GRCm39) E672G probably damaging Het
Cyp2d12 A T 15: 82,442,696 (GRCm39) I380F probably benign Het
Dock3 A T 9: 106,868,324 (GRCm39) D653E probably damaging Het
Fbxw22 A G 9: 109,211,210 (GRCm39) S364P probably damaging Het
Ift122 T C 6: 115,889,483 (GRCm39) Y823H probably benign Het
Kif20b T C 19: 34,936,819 (GRCm39) S1365P probably damaging Het
Nol11 C T 11: 107,080,032 (GRCm39) G18R probably benign Het
Or8k3 A T 2: 86,058,817 (GRCm39) L166* probably null Het
Pde8a T G 7: 80,932,740 (GRCm39) M134R probably benign Het
Pmepa1 G A 2: 173,069,926 (GRCm39) R210W probably damaging Het
Polr3gl A G 3: 96,485,862 (GRCm39) F135L probably damaging Het
Sdr16c6 T A 4: 4,062,671 (GRCm39) I216F probably damaging Het
Slc23a2 T C 2: 131,931,121 (GRCm39) D126G probably benign Het
Snx13 A T 12: 35,169,792 (GRCm39) Y579F probably benign Het
Vcan T C 13: 89,837,568 (GRCm39) T1699A probably damaging Het
Other mutations in Arpc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Arpc1a APN 5 145,032,964 (GRCm39) missense probably damaging 1.00
IGL02672:Arpc1a APN 5 145,041,697 (GRCm39) missense probably damaging 0.99
R0068:Arpc1a UTSW 5 145,028,054 (GRCm39) missense possibly damaging 0.62
R0068:Arpc1a UTSW 5 145,028,054 (GRCm39) missense possibly damaging 0.62
R1347:Arpc1a UTSW 5 145,034,082 (GRCm39) missense probably damaging 1.00
R1347:Arpc1a UTSW 5 145,034,082 (GRCm39) missense probably damaging 1.00
R1446:Arpc1a UTSW 5 145,037,896 (GRCm39) splice site probably null
R1870:Arpc1a UTSW 5 145,043,901 (GRCm39) missense possibly damaging 0.80
R1871:Arpc1a UTSW 5 145,043,901 (GRCm39) missense possibly damaging 0.80
R2154:Arpc1a UTSW 5 145,029,369 (GRCm39) missense probably benign 0.33
R3698:Arpc1a UTSW 5 145,033,001 (GRCm39) missense probably damaging 0.98
R6462:Arpc1a UTSW 5 145,045,197 (GRCm39) missense probably benign 0.01
R6720:Arpc1a UTSW 5 145,038,032 (GRCm39) splice site probably null
R6825:Arpc1a UTSW 5 145,032,936 (GRCm39) nonsense probably null
R7174:Arpc1a UTSW 5 145,034,087 (GRCm39) missense probably benign 0.38
R7473:Arpc1a UTSW 5 145,037,886 (GRCm39) missense probably benign
R7619:Arpc1a UTSW 5 145,041,668 (GRCm39) missense probably benign 0.36
R7775:Arpc1a UTSW 5 145,041,622 (GRCm39) missense probably benign 0.00
R9433:Arpc1a UTSW 5 145,045,203 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTTGGCTAACCCTGCAGAAG -3'
(R):5'- CGTAGTTAAAGAGCATCGGGC -3'

Sequencing Primer
(F):5'- CTGCAGAAGCCACTCTGAGAATG -3'
(R):5'- AGTCATGGCCCTGAAACG -3'
Posted On 2014-11-11