Incidental Mutation 'R0299:Rad21'
ID24810
Institutional Source Beutler Lab
Gene Symbol Rad21
Ensembl Gene ENSMUSG00000022314
Gene NameRAD21 cohesin complex component
SynonymsSCC1
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location51962240-51991747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51965030 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 547 (D547E)
Ref Sequence ENSEMBL: ENSMUSP00000022927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022927]
Predicted Effect probably benign
Transcript: ENSMUST00000022927
AA Change: D547E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000022927
Gene: ENSMUSG00000022314
AA Change: D547E

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 107 6.6e-43 PFAM
low complexity region 267 283 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 521 547 N/A INTRINSIC
Pfam:Rad21_Rec8 578 632 2.4e-25 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality, reduced male fertility, and produce oocytes that fail to maintain sister chromatids in the first mitosis following fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Rad21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Rad21 APN 15 51976125 missense possibly damaging 0.76
IGL01328:Rad21 APN 15 51973124 missense probably damaging 1.00
PIT4449001:Rad21 UTSW 15 51973243 missense probably benign 0.25
R0119:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0385:Rad21 UTSW 15 51973863 missense possibly damaging 0.70
R0440:Rad21 UTSW 15 51968358 missense probably benign 0.24
R1216:Rad21 UTSW 15 51970136 missense possibly damaging 0.70
R1631:Rad21 UTSW 15 51970040 missense probably damaging 1.00
R1763:Rad21 UTSW 15 51978170 missense probably damaging 1.00
R1769:Rad21 UTSW 15 51972307 missense probably benign
R2377:Rad21 UTSW 15 51968438 missense probably damaging 0.99
R2761:Rad21 UTSW 15 51982643 missense probably damaging 1.00
R3116:Rad21 UTSW 15 51965001 missense probably null 1.00
R3853:Rad21 UTSW 15 51972316 missense probably benign
R3875:Rad21 UTSW 15 51969965 missense probably damaging 0.99
R4618:Rad21 UTSW 15 51970024 missense probably damaging 1.00
R4856:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R4886:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R5022:Rad21 UTSW 15 51966706 missense probably benign 0.02
R5057:Rad21 UTSW 15 51966706 missense probably benign 0.02
R7288:Rad21 UTSW 15 51982580 missense possibly damaging 0.94
Z1088:Rad21 UTSW 15 51982626 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGCAGCCCTGGAGAAATTCCC -3'
(R):5'- TGACACCATCCAGTGTTGCACATC -3'

Sequencing Primer
(F):5'- TGGAGAAATTCCCACCAAGG -3'
(R):5'- CAGTGTTTGCTTACAAGAGCTATCC -3'
Posted On2013-04-16