Incidental Mutation 'R2404:Aifm2'
ID248869
Institutional Source Beutler Lab
Gene Symbol Aifm2
Ensembl Gene ENSMUSG00000020085
Gene Nameapoptosis-inducing factor, mitochondrion-associated 2
Synonyms5430437E11Rik, D730001I10Rik, Amid, PRG3
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61715263-61739260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61728195 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 161 (I161V)
Ref Sequence ENSEMBL: ENSMUSP00000101095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067857] [ENSMUST00000080099] [ENSMUST00000099706] [ENSMUST00000105455]
Predicted Effect probably benign
Transcript: ENSMUST00000067857
AA Change: I161V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070054
Gene: ENSMUSG00000020085
AA Change: I161V

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 291 3.2e-20 PFAM
Pfam:K_oxygenase 89 193 1.4e-7 PFAM
Pfam:Pyr_redox 145 233 4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080099
AA Change: I161V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078998
Gene: ENSMUSG00000020085
AA Change: I161V

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 12 302 5.4e-43 PFAM
Pfam:K_oxygenase 94 190 5.2e-7 PFAM
Pfam:Pyr_redox 144 230 7.2e-10 PFAM
low complexity region 328 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099706
AA Change: I161V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097297
Gene: ENSMUSG00000020085
AA Change: I161V

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 291 3.2e-20 PFAM
Pfam:K_oxygenase 89 193 1.4e-7 PFAM
Pfam:Pyr_redox 145 233 4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105455
AA Change: I161V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101095
Gene: ENSMUSG00000020085
AA Change: I161V

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 291 3.2e-20 PFAM
Pfam:K_oxygenase 89 193 1.4e-7 PFAM
Pfam:Pyr_redox 145 233 4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140664
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavoprotein oxidoreductase that binds single stranded DNA and is thought to contribute to apoptosis in the presence of bacterial and viral DNA. The expression of this gene is also found to be induced by tumor suppressor protein p53 in colon cancer cells. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice display reduced sensitivity to genotoxin induced cellular growth inhibition but have no change in spontaneous or induced tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Aifm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Aifm2 APN 10 61735548 missense possibly damaging 0.62
IGL02561:Aifm2 APN 10 61726007 missense probably damaging 1.00
IGL02708:Aifm2 APN 10 61738575 utr 3 prime probably benign
R0690:Aifm2 UTSW 10 61726452 missense probably benign 0.01
R2119:Aifm2 UTSW 10 61735604 missense possibly damaging 0.60
R4698:Aifm2 UTSW 10 61727756 missense probably benign 0.00
R4826:Aifm2 UTSW 10 61725989 missense probably benign
R5228:Aifm2 UTSW 10 61732417 missense probably damaging 0.99
R5668:Aifm2 UTSW 10 61725917 missense probably damaging 1.00
R7378:Aifm2 UTSW 10 61727717 missense possibly damaging 0.79
X0025:Aifm2 UTSW 10 61735485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCCAGTGATCCTTTGAGG -3'
(R):5'- AGATGGAAAATGTACTCTGCTTACG -3'

Sequencing Primer
(F):5'- CTTTGAGGTGGGGAGGAGCAC -3'
(R):5'- GCTGAGAGTTCATAGCCA -3'
Posted On2014-11-11