Incidental Mutation 'R2439:Nr1h3'
ID249723
Institutional Source Beutler Lab
Gene Symbol Nr1h3
Ensembl Gene ENSMUSG00000002108
Gene Namenuclear receptor subfamily 1, group H, member 3
SynonymsUnr1, LXR alpha
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2439 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91184061-91202834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91190220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000106987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002177] [ENSMUST00000111354] [ENSMUST00000111355] [ENSMUST00000111356]
Predicted Effect probably benign
Transcript: ENSMUST00000002177
AA Change: D316G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002177
Gene: ENSMUSG00000002108
AA Change: D316G

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111354
AA Change: D316G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106986
Gene: ENSMUSG00000002108
AA Change: D316G

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111355
AA Change: D256G

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106987
Gene: ENSMUSG00000002108
AA Change: D256G

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
HOLI 202 356 3.76e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111356
AA Change: D316G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106988
Gene: ENSMUSG00000002108
AA Change: D316G

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150654
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility, increased suseceptibility to bacterial infection, and diet-sensitive increase in liver size, steatosis, and cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,610,777 C127R probably damaging Het
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Btla G T 16: 45,239,140 C69F probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Micalcl A G 7: 112,394,795 E504G probably damaging Het
Mrps30 G A 13: 118,385,272 P231S probably damaging Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tmtc4 T G 14: 122,971,903 N110T probably damaging Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Umad1 T A 6: 8,427,078 D110E probably damaging Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in Nr1h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nr1h3 APN 2 91190199 missense probably damaging 1.00
IGL02198:Nr1h3 APN 2 91192725 missense probably damaging 1.00
IGL02992:Nr1h3 APN 2 91190566 missense probably damaging 1.00
IGL03103:Nr1h3 APN 2 91192015 missense probably damaging 1.00
R0302:Nr1h3 UTSW 2 91192013 missense probably damaging 0.98
R0350:Nr1h3 UTSW 2 91191825 missense possibly damaging 0.68
R2397:Nr1h3 UTSW 2 91191857 missense possibly damaging 0.81
R2988:Nr1h3 UTSW 2 91185004 missense probably damaging 0.96
R3431:Nr1h3 UTSW 2 91191860 missense probably damaging 1.00
R4842:Nr1h3 UTSW 2 91190218 missense probably benign 0.09
R5355:Nr1h3 UTSW 2 91191908 missense possibly damaging 0.67
R6137:Nr1h3 UTSW 2 91191851 missense probably damaging 1.00
R6982:Nr1h3 UTSW 2 91190759 missense probably damaging 0.98
R7380:Nr1h3 UTSW 2 91190195 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGACGCTTGTTGCATCAACTCC -3'
(R):5'- ACCTCCAGATATCCAGCTTGG -3'

Sequencing Primer
(F):5'- AGATGCTTCCATGGCTGATCAAC -3'
(R):5'- GGAGAGTCCAAGCCACAGG -3'
Posted On2014-11-12