Incidental Mutation 'R2429:Syt1'
ID250351
Institutional Source Beutler Lab
Gene Symbol Syt1
Ensembl Gene ENSMUSG00000035864
Gene Namesynaptotagmin I
Synonyms
MMRRC Submission 040391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2429 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location108497650-109010982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108690920 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 43 (K43E)
Ref Sequence ENSEMBL: ENSMUSP00000100912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064054] [ENSMUST00000105276]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064054
AA Change: K43E

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063293
Gene: ENSMUSG00000035864
AA Change: K43E

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.8e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105276
AA Change: K43E

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100912
Gene: ENSMUSG00000035864
AA Change: K43E

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.9e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156979
SMART Domains Protein: ENSMUSP00000116981
Gene: ENSMUSG00000035864

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 7e-6 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 128 138 N/A INTRINSIC
C2 154 236 2.83e-6 SMART
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous null mice do not suckle, show impaired synaptic transmission and Ca2+-evoked neurotransmitter release, and die by 48 hrs of life. Knock-in mice bearing a missense mutation show enhanced synaptic depression while those carrying a point mutationshow reduced synaptic release probability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930470P17Rik A T 2: 170,579,825 M45K unknown Het
Abcd3 A G 3: 121,792,863 F63L probably damaging Het
Acsm3 A T 7: 119,768,000 M19L probably benign Het
Actn4 T C 7: 28,898,071 K41E probably benign Het
Atp8b3 T A 10: 80,526,894 I677L probably benign Het
Auh C T 13: 52,919,016 G110R probably damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cntn6 T C 6: 104,650,565 Y120H possibly damaging Het
Gnpat T C 8: 124,877,019 F212S probably damaging Het
Gpd1 A G 15: 99,720,607 M181V probably benign Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kif21a G A 15: 90,998,005 T32M probably damaging Het
Macf1 A G 4: 123,432,584 V3477A probably damaging Het
Mettl13 A T 1: 162,546,325 L119* probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh8 A G 11: 67,303,897 N1645D probably benign Het
Myo6 T C 9: 80,303,301 probably null Het
Npffr2 A T 5: 89,583,147 Y312F probably damaging Het
Pla2r1 C A 2: 60,514,968 C348F probably damaging Het
Plcb1 A G 2: 135,337,442 N590S probably damaging Het
Prpsap1 G A 11: 116,472,235 T314M probably damaging Het
Prss35 T C 9: 86,755,345 V56A probably benign Het
Setx T C 2: 29,179,898 S2572P probably benign Het
Sf3b1 T C 1: 55,016,801 D93G possibly damaging Het
Slc26a7 C A 4: 14,506,399 probably benign Het
Slc39a12 T G 2: 14,405,086 S298A probably benign Het
Sorl1 G T 9: 42,037,070 D806E probably damaging Het
Trmt1l T A 1: 151,433,830 L88Q probably damaging Het
Zfp334 G A 2: 165,380,512 T537I probably damaging Het
Zfp574 T A 7: 25,080,057 L168* probably null Het
Other mutations in Syt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01793:Syt1 APN 10 108583975 missense possibly damaging 0.49
R1067:Syt1 UTSW 10 108636662 missense probably benign
R1300:Syt1 UTSW 10 108631821 missense possibly damaging 0.95
R1370:Syt1 UTSW 10 108690922 missense probably damaging 0.98
R1575:Syt1 UTSW 10 108504500 missense probably benign 0.04
R1656:Syt1 UTSW 10 108583915 missense probably damaging 1.00
R2072:Syt1 UTSW 10 108583972 missense probably damaging 1.00
R2212:Syt1 UTSW 10 108504414 missense possibly damaging 0.89
R4928:Syt1 UTSW 10 108504512 missense possibly damaging 0.95
R5216:Syt1 UTSW 10 108642257 missense probably benign 0.00
R6161:Syt1 UTSW 10 108631807 missense probably damaging 1.00
R6193:Syt1 UTSW 10 108500736 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGCACTACTGTTATCAGAGAAACAG -3'
(R):5'- GCATGGCGTTCTGAATTGGC -3'

Sequencing Primer
(F):5'- TCAGAGAAACAGAAAATGAAGGATC -3'
(R):5'- GCGTTCTGAATTGGCTTTCTC -3'
Posted On2014-11-12