Incidental Mutation 'R2764:Adam29'
ID254202
Institutional Source Beutler Lab
Gene Symbol Adam29
Ensembl Gene ENSMUSG00000046258
Gene Namea disintegrin and metallopeptidase domain 29
Synonyms
Accession Numbers

Genbank: NM_175939; MGI: 2676326

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2764 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location55870912-55906948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55871756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 554 (D554E)
Ref Sequence ENSEMBL: ENSMUSP00000054292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053441]
Predicted Effect probably damaging
Transcript: ENSMUST00000053441
AA Change: D554E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054292
Gene: ENSMUSG00000046258
AA Change: D554E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 159 1.9e-17 PFAM
Pfam:Reprolysin_4 203 394 3.3e-10 PFAM
Pfam:Reprolysin_5 203 403 6.9e-15 PFAM
Pfam:Reprolysin 205 395 1.5e-48 PFAM
Pfam:Reprolysin_2 226 386 7.4e-11 PFAM
Pfam:Reprolysin_3 228 349 1.4e-11 PFAM
DISIN 412 487 4.26e-37 SMART
ACR 488 624 2.85e-58 SMART
low complexity region 642 651 N/A INTRINSIC
transmembrane domain 683 705 N/A INTRINSIC
low complexity region 713 746 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Bcl2 C T 1: 106,712,436 E149K probably damaging Het
Clcn4 G T 7: 7,296,799 D10E possibly damaging Het
Efr3a T A 15: 65,849,770 F387L possibly damaging Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Hmcn2 C T 2: 31,388,298 P1671S probably damaging Het
Htr1d G A 4: 136,443,065 A202T possibly damaging Het
Ighv9-3 T A 12: 114,140,870 Q58L probably damaging Het
Kat6a A G 8: 22,932,178 K835E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Mrps30 A G 13: 118,384,588 Y272H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sipa1l2 T C 8: 125,492,374 M75V probably damaging Het
Ttn T A 2: 76,791,095 Y13921F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vac14 T C 8: 110,710,455 F600S probably damaging Het
Other mutations in Adam29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Adam29 APN 8 55871844 missense probably benign 0.01
IGL01406:Adam29 APN 8 55871839 missense probably damaging 1.00
IGL01511:Adam29 APN 8 55871421 missense probably damaging 1.00
IGL01869:Adam29 APN 8 55871697 missense probably damaging 0.99
IGL01894:Adam29 APN 8 55871830 missense probably benign 0.00
IGL02023:Adam29 APN 8 55872484 missense probably benign 0.12
IGL02030:Adam29 APN 8 55872122 missense probably benign 0.35
IGL02071:Adam29 APN 8 55871554 missense possibly damaging 0.95
IGL02094:Adam29 APN 8 55871445 missense possibly damaging 0.48
IGL02108:Adam29 APN 8 55872311 missense probably damaging 0.98
IGL02125:Adam29 APN 8 55871939 nonsense probably null
IGL02330:Adam29 APN 8 55872363 missense probably benign 0.02
IGL02332:Adam29 APN 8 55871740 missense probably damaging 1.00
IGL02548:Adam29 APN 8 55872867 nonsense probably null
IGL02960:Adam29 APN 8 55872666 nonsense probably null
IGL03030:Adam29 APN 8 55873065 missense probably damaging 1.00
ANU22:Adam29 UTSW 8 55871844 missense probably benign 0.01
D4043:Adam29 UTSW 8 55872461 nonsense probably null
IGL02835:Adam29 UTSW 8 55873138 missense probably damaging 1.00
R0294:Adam29 UTSW 8 55873276 missense probably benign 0.25
R0449:Adam29 UTSW 8 55872681 missense probably benign 0.01
R0607:Adam29 UTSW 8 55873275 missense probably damaging 1.00
R0626:Adam29 UTSW 8 55871577 missense probably benign 0.24
R1296:Adam29 UTSW 8 55871719 nonsense probably null
R1752:Adam29 UTSW 8 55872274 missense probably damaging 0.98
R1930:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R1931:Adam29 UTSW 8 55873089 missense probably damaging 1.00
R2397:Adam29 UTSW 8 55872898 missense probably benign 0.04
R4052:Adam29 UTSW 8 55872282 missense probably damaging 1.00
R4978:Adam29 UTSW 8 55871401 missense probably damaging 0.98
R5306:Adam29 UTSW 8 55871757 missense probably damaging 1.00
R6383:Adam29 UTSW 8 55871508 missense probably damaging 0.99
R6528:Adam29 UTSW 8 55872561 missense possibly damaging 0.93
R6579:Adam29 UTSW 8 55872744 missense probably damaging 1.00
R6707:Adam29 UTSW 8 55872100 missense probably damaging 1.00
R7076:Adam29 UTSW 8 55871659 missense probably damaging 1.00
R7099:Adam29 UTSW 8 55871404 missense probably benign 0.01
R7177:Adam29 UTSW 8 55872624 missense probably benign 0.30
R7320:Adam29 UTSW 8 55872714 missense possibly damaging 0.50
X0011:Adam29 UTSW 8 55873168 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGGTGTACAGTTGCTGTC -3'
(R):5'- AAGATGGAATTCCCTGTGGG -3'

Sequencing Primer
(F):5'- CAGATATGATTTTGCTCACACTCTG -3'
(R):5'- GGGGTCTCAGCCTATTGC -3'
Posted On2014-12-04