Mutagenetix > Incidental Mutation

Incidental Mutation 'R2959:Gpd2'

255851

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.593) question?

Stock #

R2959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57127690-57260731 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 57228987 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 264 (R264*)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably null
Transcript: ENSMUST00000028167
AA Change: R264*

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: R264*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112618
AA Change: R264*

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: R264*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

probably null
Transcript: ENSMUST00000169687
AA Change: R264*

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: R264*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl4	G	A	17: 33,996,008 (GRCm39)	P323S	possibly damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,208,214 (GRCm39)		probably null	Het
Dnajc16	T	A	4: 141,493,856 (GRCm39)	K571*	probably null	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 118,989,784 (GRCm39)		probably null	Het
Gm5407	A	T	16: 49,117,326 (GRCm39)		noncoding transcript	Het
H2-M2	T	C	17: 37,794,345 (GRCm39)	T26A	probably benign	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Prpf39	T	C	12: 65,089,297 (GRCm39)	S12P	probably damaging	Het
Prss1	G	T	6: 41,440,172 (GRCm39)	D170Y	probably damaging	Het
Satb1	T	C	17: 52,082,331 (GRCm39)	D441G	possibly damaging	Het
Tas2r106	A	T	6: 131,655,068 (GRCm39)	L261*	probably null	Het
Zfp719	T	A	7: 43,239,851 (GRCm39)	S480T	possibly damaging	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57,158,096 (GRCm39)	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57,254,542 (GRCm39)	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57,228,879 (GRCm39)	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57,158,083 (GRCm39)	nonsense	probably null
IGL01816:Gpd2	APN	2	57,254,078 (GRCm39)	nonsense	probably null
IGL02257:Gpd2	APN	2	57,254,536 (GRCm39)	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57,254,339 (GRCm39)	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57,228,991 (GRCm39)	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57,245,805 (GRCm39)	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57,245,581 (GRCm39)	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57,228,855 (GRCm39)	splice site	probably benign
IGL03218:Gpd2	APN	2	57,197,066 (GRCm39)	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57,194,498 (GRCm39)	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57,245,519 (GRCm39)	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57,228,880 (GRCm39)	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57,228,967 (GRCm39)	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57,235,275 (GRCm39)	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57,230,105 (GRCm39)	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57,247,683 (GRCm39)	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57,247,683 (GRCm39)	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57,245,786 (GRCm39)	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57,245,786 (GRCm39)	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57,245,487 (GRCm39)	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57,247,712 (GRCm39)	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57,247,667 (GRCm39)	missense	probably damaging	1.00
R1735:Gpd2	UTSW	2	57,245,563 (GRCm39)	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57,229,025 (GRCm39)	critical splice donor site	probably null
R2960:Gpd2	UTSW	2	57,228,987 (GRCm39)	nonsense	probably null
R2961:Gpd2	UTSW	2	57,228,987 (GRCm39)	nonsense	probably null
R2962:Gpd2	UTSW	2	57,228,987 (GRCm39)	nonsense	probably null
R3008:Gpd2	UTSW	2	57,228,987 (GRCm39)	nonsense	probably null
R3009:Gpd2	UTSW	2	57,228,987 (GRCm39)	nonsense	probably null
R3881:Gpd2	UTSW	2	57,228,987 (GRCm39)	nonsense	probably null
R4073:Gpd2	UTSW	2	57,180,025 (GRCm39)	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57,245,783 (GRCm39)	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57,197,095 (GRCm39)	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57,197,025 (GRCm39)	nonsense	probably null
R5030:Gpd2	UTSW	2	57,194,417 (GRCm39)	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57,245,913 (GRCm39)	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57,230,216 (GRCm39)	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57,254,525 (GRCm39)	missense	probably benign	0.18
R6325:Gpd2	UTSW	2	57,194,408 (GRCm39)	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57,235,367 (GRCm39)	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57,245,800 (GRCm39)	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57,197,112 (GRCm39)	splice site	probably null
R7380:Gpd2	UTSW	2	57,230,171 (GRCm39)	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57,196,962 (GRCm39)	nonsense	probably null
R8098:Gpd2	UTSW	2	57,180,020 (GRCm39)	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57,254,596 (GRCm39)	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57,197,062 (GRCm39)	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57,195,866 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGTTGTGACACACTTCTGTACC -3'
(R):5'- ATGTTAAGCCAGGCATTGTTGAC -3'

Sequencing Primer
(F):5'- TGACACACTTCTGTACCACCCG -3'
(R):5'- GACTGAAGTCTGCCTTTC -3'

Posted On

2014-12-29