Mutagenetix > Incidental Mutation

Incidental Mutation 'R2996:Arid5b'

257186

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT-rich interaction domain 5B

Synonyms

Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt

Accession Numbers

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R2996 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67928350-68114570 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 67934292 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 294 (G294S)

Ref Sequence

ENSEMBL: ENSMUSP00000151665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably benign
Transcript: ENSMUST00000020106

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218532
AA Change: G294S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000219238
AA Change: G537S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
F5	C	A	1: 164,010,486 (GRCm39)	R406S	probably damaging	Het
Fam43a	A	G	16: 30,419,838 (GRCm39)	T141A	possibly damaging	Het
Gpsm1	G	A	2: 26,209,843 (GRCm39)		probably benign	Het
Gtpbp3	G	A	8: 71,942,140 (GRCm39)	G125S	possibly damaging	Het
Lmbr1	A	G	5: 29,568,931 (GRCm39)	I30T	probably benign	Het
Map2k7	C	A	8: 4,293,775 (GRCm39)	N138K	probably benign	Het
Mdc1	TGAGGAGGAGGAGGAGGAGGAGGAGGAGG	TGAGGAGGAGGAGGAGGAGGAGGAGG	17: 36,158,785 (GRCm39)		probably benign	Het
Mmab	C	A	5: 114,574,555 (GRCm39)	R184L	probably damaging	Het
Nsun7	T	A	5: 66,452,897 (GRCm39)	H571Q	probably benign	Het
Pfkp	A	G	13: 6,685,966 (GRCm39)	Y23H	probably benign	Het
Rptor	T	A	11: 119,747,124 (GRCm39)	V13D	probably damaging	Het
Vmn1r90	T	C	7: 14,295,459 (GRCm39)	H213R	probably damaging	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	67,964,805 (GRCm39)	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	67,933,439 (GRCm39)	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	67,933,229 (GRCm39)	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	67,932,498 (GRCm39)	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	67,937,734 (GRCm39)	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	67,937,780 (GRCm39)	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68,079,057 (GRCm39)	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	67,933,287 (GRCm39)	missense	possibly damaging	0.73
gobi	UTSW	10	67,954,175 (GRCm39)	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	67,934,419 (GRCm39)	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	67,933,841 (GRCm39)	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68,114,559 (GRCm39)	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	67,933,676 (GRCm39)	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68,021,863 (GRCm39)	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	67,932,807 (GRCm39)	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	67,934,186 (GRCm39)	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	67,933,044 (GRCm39)	nonsense	probably null
R1638:Arid5b	UTSW	10	68,113,777 (GRCm39)	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68,021,897 (GRCm39)	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68,114,518 (GRCm39)	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	67,933,607 (GRCm39)	missense	possibly damaging	0.63
R2997:Arid5b	UTSW	10	67,934,292 (GRCm39)	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	67,934,292 (GRCm39)	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	67,932,519 (GRCm39)	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68,078,925 (GRCm39)	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68,078,925 (GRCm39)	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68,113,940 (GRCm39)	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68,113,957 (GRCm39)	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	67,932,719 (GRCm39)	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	67,937,909 (GRCm39)	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	67,933,574 (GRCm39)	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	67,933,412 (GRCm39)	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	67,934,391 (GRCm39)	nonsense	probably null
R6525:Arid5b	UTSW	10	67,933,496 (GRCm39)	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68,022,042 (GRCm39)	nonsense	probably null
R7013:Arid5b	UTSW	10	67,933,649 (GRCm39)	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	67,934,009 (GRCm39)	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	67,933,637 (GRCm39)	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	67,964,752 (GRCm39)	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68,079,007 (GRCm39)	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	67,954,096 (GRCm39)	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68,078,994 (GRCm39)	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	67,954,175 (GRCm39)	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7661:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7662:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7663:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7665:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7666:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7759:Arid5b	UTSW	10	67,933,632 (GRCm39)	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	67,932,606 (GRCm39)	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7789:Arid5b	UTSW	10	67,934,417 (GRCm39)	missense	probably benign
R7875:Arid5b	UTSW	10	67,964,771 (GRCm39)	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	67,934,186 (GRCm39)	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68,021,982 (GRCm39)	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68,114,536 (GRCm39)	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	67,933,217 (GRCm39)	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	67,933,640 (GRCm39)	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	67,934,108 (GRCm39)	missense
R8954:Arid5b	UTSW	10	67,937,810 (GRCm39)	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	67,964,628 (GRCm39)	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	67,937,882 (GRCm39)	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68,022,087 (GRCm39)	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	67,954,132 (GRCm39)	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	67,933,058 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTTGGAGGTCCTTCTCAG -3'
(R):5'- GCGTGCATGGTTCTCTTCTAAC -3'

Sequencing Primer
(F):5'- TCTCAGGGCTCTCTGTAAAGCAG -3'
(R):5'- TTCCAGGTTTCATCAGAGCAAAGG -3'

Posted On

2015-01-11