Mutagenetix > Incidental Mutation

Incidental Mutation 'R3004:Sox17'

257382

Institutional Source

Beutler Lab

Gene Symbol

Sox17

Ensembl Gene

ENSMUSG00000025902

Gene Name

SRY (sex determining region Y)-box 17

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4561154-4567577 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4562840 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 120 (E120G)

Ref Sequence

ENSEMBL: ENSMUSP00000141674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027035] [ENSMUST00000116652] [ENSMUST00000191647] [ENSMUST00000191939] [ENSMUST00000192650] [ENSMUST00000192913] [ENSMUST00000195555]

AlphaFold

Q61473

Predicted Effect

probably damaging
Transcript: ENSMUST00000027035
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027035
Gene: ENSMUSG00000025902
AA Change: E120G

Domain	Start	End	E-Value	Type
HMG	67	137	1.57e-28	SMART
low complexity region	182	193	N/A	INTRINSIC
Pfam:Sox_C_TAD	197	417	9.5e-56	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000116652
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112351
Gene: ENSMUSG00000025902
AA Change: E120G

Domain	Start	End	E-Value	Type
HMG	67	137	1.57e-28	SMART
low complexity region	182	193	N/A	INTRINSIC
Pfam:Sox_C_TAD	197	330	9.8e-19	PFAM
Pfam:Sox_C_TAD	312	418	1.6e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000191647
AA Change: E55G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142204
Gene: ENSMUSG00000025902
AA Change: E55G

Domain	Start	End	E-Value	Type
Pfam:HMG_box	36	71	3.7e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000191939
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142154
Gene: ENSMUSG00000025902
AA Change: E120G

Domain	Start	End	E-Value	Type
HMG	67	137	6.3e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192505

Predicted Effect

probably damaging
Transcript: ENSMUST00000192650
AA Change: E55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142116
Gene: ENSMUSG00000025902
AA Change: E55G

Domain	Start	End	E-Value	Type
Pfam:HMG_box	36	71	2.5e-7	PFAM
low complexity region	117	128	N/A	INTRINSIC
Pfam:Sox_C_TAD	132	266	6.1e-16	PFAM
Pfam:Sox_C_TAD	255	353	4.4e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000192913
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141674
Gene: ENSMUSG00000025902
AA Change: E120G

Domain	Start	End	E-Value	Type
HMG	67	137	6.3e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194935

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193450

Predicted Effect

probably benign
Transcript: ENSMUST00000195555

SMART Domains

Protein: ENSMUSP00000141894
Gene: ENSMUSG00000025902

Domain	Start	End	E-Value	Type
SCOP:d2lefa_	1	21	6e-4	SMART
low complexity region	54	65	N/A	INTRINSIC
Pfam:Sox_C_TAD	69	202	4.6e-16	PFAM
Pfam:Sox_C_TAD	192	290	3.1e-27	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation develop a deficient gut endoderm and die around embryonic day 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk3	G	A	7: 80,753,103 (GRCm39)	W1553*	probably null	Het
Art2a	T	C	7: 101,203,972 (GRCm39)	I189V	probably benign	Het
BC049715	A	G	6: 136,816,790 (GRCm39)	E10G	possibly damaging	Het
Ccdc158	A	G	5: 92,796,929 (GRCm39)	L469P	probably damaging	Het
Cspg4b	T	C	13: 113,502,688 (GRCm39)	F131S	probably damaging	Het
Ctsm	T	C	13: 61,687,682 (GRCm39)	I59V	possibly damaging	Het
Daam2	A	G	17: 49,767,682 (GRCm39)	F970L	probably damaging	Het
Gm21903	A	T	17: 39,353,547 (GRCm39)		probably benign	Het
Gpr158	T	A	2: 21,831,810 (GRCm39)	M970K	probably damaging	Het
H2bc7	G	A	13: 23,758,355 (GRCm39)		probably benign	Het
Hoxd10	T	A	2: 74,522,706 (GRCm39)	V128D	probably benign	Het
Ighv5-9	T	C	12: 113,625,567 (GRCm39)	T59A	probably benign	Het
Nlrp4c	G	A	7: 6,068,524 (GRCm39)	V142M	probably benign	Het
Npc1	A	G	18: 12,330,311 (GRCm39)	F947L	probably benign	Het
Or1ak2	T	A	2: 36,827,221 (GRCm39)	I30N	possibly damaging	Het
Or56b1b	G	T	7: 108,164,151 (GRCm39)	H284N	probably benign	Het
Piezo2	G	T	18: 63,157,506 (GRCm39)	Y223*	probably null	Het
Rhog	A	T	7: 101,889,345 (GRCm39)	V36E	probably damaging	Het
Sbno1	G	A	5: 124,519,771 (GRCm39)	T1168I	probably damaging	Het
Sin3a	T	A	9: 57,004,118 (GRCm39)	L290*	probably null	Het
Slco1c1	G	T	6: 141,478,380 (GRCm39)	A48S	probably damaging	Het
Slfn9	A	T	11: 82,872,590 (GRCm39)	S715R	possibly damaging	Het

Other mutations in Sox17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01025:Sox17	APN	1	4,562,426 (GRCm39)	missense	possibly damaging	0.66
rheas	UTSW	1	4,562,655 (GRCm39)	missense	possibly damaging	0.71
R1160:Sox17	UTSW	1	4,562,075 (GRCm39)	missense	probably damaging	1.00
R1503:Sox17	UTSW	1	4,562,151 (GRCm39)	missense	probably damaging	1.00
R2911:Sox17	UTSW	1	4,563,354 (GRCm39)	missense	probably damaging	1.00
R3508:Sox17	UTSW	1	4,562,378 (GRCm39)	missense	probably damaging	0.98
R4596:Sox17	UTSW	1	4,562,860 (GRCm39)	missense	possibly damaging	0.91
R5274:Sox17	UTSW	1	4,562,111 (GRCm39)	missense	possibly damaging	0.74
R6544:Sox17	UTSW	1	4,562,655 (GRCm39)	missense	possibly damaging	0.71
R7496:Sox17	UTSW	1	4,562,550 (GRCm39)	missense	probably damaging	0.96
R7704:Sox17	UTSW	1	4,563,895 (GRCm39)	intron	probably benign
R8446:Sox17	UTSW	1	4,562,316 (GRCm39)	missense	possibly damaging	0.95
R8851:Sox17	UTSW	1	4,562,073 (GRCm39)	missense	probably benign	0.04
R9155:Sox17	UTSW	1	4,562,447 (GRCm39)	missense	probably damaging	1.00
Z1088:Sox17	UTSW	1	4,562,525 (GRCm39)	missense	probably damaging	1.00
Z1177:Sox17	UTSW	1	4,562,696 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCATAGTCCGAGACTGG -3'
(R):5'- GCGATCTAACACTTTCATCCG -3'

Sequencing Primer
(F):5'- AAAGAAAGCCGGGTCCTGCTC -3'
(R):5'- GAATAGGACCGGGCTTCTCAC -3'

Posted On

2015-01-11