Incidental Mutation 'R2985:Trpm5'
ID 257783
Institutional Source Beutler Lab
Gene Symbol Trpm5
Ensembl Gene ENSMUSG00000009246
Gene Name transient receptor potential cation channel, subfamily M, member 5
Synonyms Ltrpc5, 9430099A16Rik, Mtr1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2985 (G1)
Quality Score 164
Status Not validated
Chromosome 7
Chromosomal Location 142625266-142648379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 142636675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 421 (L421I)
Ref Sequence ENSEMBL: ENSMUSP00000114302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]
AlphaFold Q9JJH7
Predicted Effect probably damaging
Transcript: ENSMUST00000009390
AA Change: L421I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: L421I

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150589
Predicted Effect probably damaging
Transcript: ENSMUST00000150867
AA Change: L421I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: L421I

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Ccdc83 A G 7: 89,885,575 (GRCm39) probably benign Het
Chil4 G A 3: 106,111,043 (GRCm39) P284S possibly damaging Het
Cul1 T A 6: 47,479,441 (GRCm39) F236I probably damaging Het
Etl4 T C 2: 20,786,660 (GRCm39) V470A probably damaging Het
Fndc1 T C 17: 7,975,155 (GRCm39) E1428G possibly damaging Het
Gal3st1 A G 11: 3,948,618 (GRCm39) Y275C probably damaging Het
Jakmip2 G A 18: 43,704,246 (GRCm39) T366I possibly damaging Het
Mfsd13a C T 19: 46,360,431 (GRCm39) R328C probably damaging Het
Obscn A G 11: 59,023,915 (GRCm39) F585S probably damaging Het
Or8b56 G A 9: 38,739,406 (GRCm39) V140I probably benign Het
Oxld1 T C 11: 120,347,862 (GRCm39) T112A probably benign Het
Pcdha9 A G 18: 37,131,255 (GRCm39) N108S possibly damaging Het
Pkd1l2 T C 8: 117,792,290 (GRCm39) S501G probably benign Het
Pls1 G A 9: 95,667,635 (GRCm39) T91M possibly damaging Het
Prr12 G C 7: 44,695,436 (GRCm39) S1343R unknown Het
Ttn A T 2: 76,574,618 (GRCm39) V25425E probably damaging Het
Zfp112 A G 7: 23,821,720 (GRCm39) D20G probably benign Het
Other mutations in Trpm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Trpm5 APN 7 142,636,728 (GRCm39) missense probably benign 0.03
IGL00717:Trpm5 APN 7 142,627,727 (GRCm39) missense probably damaging 1.00
IGL01138:Trpm5 APN 7 142,628,306 (GRCm39) missense probably benign
IGL01590:Trpm5 APN 7 142,636,471 (GRCm39) missense probably damaging 0.99
IGL01603:Trpm5 APN 7 142,629,338 (GRCm39) missense probably benign 0.04
IGL01685:Trpm5 APN 7 142,636,091 (GRCm39) missense probably benign 0.05
IGL01878:Trpm5 APN 7 142,628,234 (GRCm39) missense probably damaging 1.00
IGL02533:Trpm5 APN 7 142,643,282 (GRCm39) missense probably benign 0.01
IGL02572:Trpm5 APN 7 142,641,613 (GRCm39) splice site probably benign
IGL02750:Trpm5 APN 7 142,628,221 (GRCm39) missense possibly damaging 0.89
IGL02862:Trpm5 APN 7 142,636,262 (GRCm39) missense probably damaging 1.00
R0032:Trpm5 UTSW 7 142,638,978 (GRCm39) missense probably damaging 1.00
R0238:Trpm5 UTSW 7 142,636,695 (GRCm39) missense probably damaging 1.00
R0238:Trpm5 UTSW 7 142,636,695 (GRCm39) missense probably damaging 1.00
R0239:Trpm5 UTSW 7 142,636,695 (GRCm39) missense probably damaging 1.00
R0239:Trpm5 UTSW 7 142,636,695 (GRCm39) missense probably damaging 1.00
R0334:Trpm5 UTSW 7 142,640,613 (GRCm39) missense probably benign 0.06
R0799:Trpm5 UTSW 7 142,632,088 (GRCm39) missense probably damaging 0.99
R1187:Trpm5 UTSW 7 142,628,206 (GRCm39) missense probably damaging 0.96
R1373:Trpm5 UTSW 7 142,640,579 (GRCm39) splice site probably benign
R1521:Trpm5 UTSW 7 142,636,626 (GRCm39) missense probably benign 0.00
R1603:Trpm5 UTSW 7 142,638,946 (GRCm39) missense probably benign 0.00
R1606:Trpm5 UTSW 7 142,638,908 (GRCm39) nonsense probably null
R2009:Trpm5 UTSW 7 142,641,475 (GRCm39) missense possibly damaging 0.58
R2437:Trpm5 UTSW 7 142,636,298 (GRCm39) missense probably benign 0.03
R2508:Trpm5 UTSW 7 142,642,656 (GRCm39) missense possibly damaging 0.80
R2516:Trpm5 UTSW 7 142,628,254 (GRCm39) missense probably damaging 1.00
R3036:Trpm5 UTSW 7 142,639,200 (GRCm39) missense probably benign 0.00
R3037:Trpm5 UTSW 7 142,639,200 (GRCm39) missense probably benign 0.00
R3688:Trpm5 UTSW 7 142,632,193 (GRCm39) missense probably damaging 0.98
R4156:Trpm5 UTSW 7 142,642,792 (GRCm39) missense probably benign 0.04
R4734:Trpm5 UTSW 7 142,636,522 (GRCm39) missense probably benign 0.04
R4811:Trpm5 UTSW 7 142,633,956 (GRCm39) missense probably damaging 1.00
R4814:Trpm5 UTSW 7 142,636,373 (GRCm39) missense possibly damaging 0.50
R4847:Trpm5 UTSW 7 142,641,500 (GRCm39) missense possibly damaging 0.89
R5055:Trpm5 UTSW 7 142,626,521 (GRCm39) missense probably benign 0.00
R5256:Trpm5 UTSW 7 142,636,040 (GRCm39) missense probably damaging 1.00
R5413:Trpm5 UTSW 7 142,634,705 (GRCm39) missense probably damaging 1.00
R5668:Trpm5 UTSW 7 142,626,966 (GRCm39) missense probably benign 0.39
R6133:Trpm5 UTSW 7 142,642,688 (GRCm39) missense probably damaging 0.98
R6242:Trpm5 UTSW 7 142,626,919 (GRCm39) missense probably benign
R6564:Trpm5 UTSW 7 142,626,507 (GRCm39) missense probably damaging 1.00
R6702:Trpm5 UTSW 7 142,623,055 (GRCm39) unclassified probably benign
R6703:Trpm5 UTSW 7 142,623,055 (GRCm39) unclassified probably benign
R6829:Trpm5 UTSW 7 142,623,166 (GRCm39) unclassified probably benign
R6940:Trpm5 UTSW 7 142,638,547 (GRCm39) nonsense probably null
R7337:Trpm5 UTSW 7 142,642,756 (GRCm39) missense probably benign 0.01
R7513:Trpm5 UTSW 7 142,635,572 (GRCm39) missense possibly damaging 0.84
R7560:Trpm5 UTSW 7 142,634,723 (GRCm39) missense probably damaging 1.00
R7801:Trpm5 UTSW 7 142,638,978 (GRCm39) missense probably damaging 1.00
R7961:Trpm5 UTSW 7 142,634,106 (GRCm39) missense probably benign 0.00
R8009:Trpm5 UTSW 7 142,634,106 (GRCm39) missense probably benign 0.00
R8189:Trpm5 UTSW 7 142,635,575 (GRCm39) missense probably benign 0.32
R8441:Trpm5 UTSW 7 142,626,171 (GRCm39) missense possibly damaging 0.75
R8507:Trpm5 UTSW 7 142,632,050 (GRCm39) missense probably damaging 1.00
R8825:Trpm5 UTSW 7 142,636,753 (GRCm39) missense possibly damaging 0.94
R9443:Trpm5 UTSW 7 142,638,860 (GRCm39) missense probably benign
R9577:Trpm5 UTSW 7 142,633,131 (GRCm39) critical splice donor site probably null
R9608:Trpm5 UTSW 7 142,633,148 (GRCm39) missense possibly damaging 0.83
R9647:Trpm5 UTSW 7 142,634,498 (GRCm39) missense possibly damaging 0.95
X0022:Trpm5 UTSW 7 142,636,779 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGTCTTTGAGTACGCGGG -3'
(R):5'- TCTTATCCCTGGCACCTGAG -3'

Sequencing Primer
(F):5'- GGAGACCTCGTGGAGTGAG -3'
(R):5'- TCCAGGGGAGGATGTTCAC -3'
Posted On 2015-01-11