Incidental Mutation 'R2985:Pls1'
ID257787
Institutional Source Beutler Lab
Gene Symbol Pls1
Ensembl Gene ENSMUSG00000049493
Gene Nameplastin 1 (I-isoform)
SynonymsI-fimbrin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R2985 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95752642-95845311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95785582 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 91 (T91M)
Ref Sequence ENSEMBL: ENSMUSP00000113200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093800] [ENSMUST00000119760]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093800
AA Change: T91M

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: T91M

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
CH 124 236 3.69e-23 SMART
CH 268 375 4.4e-21 SMART
CH 398 503 7.27e-22 SMART
CH 519 624 3.75e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119760
AA Change: T91M

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113200
Gene: ENSMUSG00000049493
AA Change: T91M

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
PDB:1AOA|A 117 138 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135816
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ccdc83 A G 7: 90,236,367 probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cul1 T A 6: 47,502,507 F236I probably damaging Het
Etl4 T C 2: 20,781,849 V470A probably damaging Het
Fndc1 T C 17: 7,756,323 E1428G possibly damaging Het
Gal3st1 A G 11: 3,998,618 Y275C probably damaging Het
Jakmip2 G A 18: 43,571,181 T366I possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Obscn A G 11: 59,133,089 F585S probably damaging Het
Olfr923 G A 9: 38,828,110 V140I probably benign Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Pcdha9 A G 18: 36,998,202 N108S possibly damaging Het
Pkd1l2 T C 8: 117,065,551 S501G probably benign Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Trpm5 G T 7: 143,082,938 L421I probably damaging Het
Ttn A T 2: 76,744,274 V25425E probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Other mutations in Pls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pls1 APN 9 95782419 missense possibly damaging 0.95
IGL00836:Pls1 APN 9 95761422 missense possibly damaging 0.86
IGL01391:Pls1 APN 9 95773698 missense probably benign 0.38
IGL02335:Pls1 APN 9 95784183 missense probably benign 0.32
IGL02875:Pls1 APN 9 95754351 missense possibly damaging 0.93
IGL03081:Pls1 APN 9 95773643 missense probably damaging 1.00
IGL03271:Pls1 APN 9 95776830 missense probably benign 0.04
R0048:Pls1 UTSW 9 95787063 missense probably damaging 1.00
R0088:Pls1 UTSW 9 95795768 missense possibly damaging 0.93
R0409:Pls1 UTSW 9 95786919 splice site probably benign
R2015:Pls1 UTSW 9 95761365 missense possibly damaging 0.77
R2516:Pls1 UTSW 9 95776563 missense probably benign 0.00
R3964:Pls1 UTSW 9 95785612 missense probably benign 0.00
R3965:Pls1 UTSW 9 95785612 missense probably benign 0.00
R5240:Pls1 UTSW 9 95776622 splice site probably null
R5681:Pls1 UTSW 9 95787012 missense probably damaging 1.00
R6399:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6441:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6496:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6498:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6499:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R7016:Pls1 UTSW 9 95786941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCACAACGGCAGCTTAGG -3'
(R):5'- CTTGTGGTTGCGTTACAGAC -3'

Sequencing Primer
(F):5'- GCTGGAAGACATTTACTAACGGCATC -3'
(R):5'- CCATTTTGTGCGATCGGTAAAATG -3'
Posted On2015-01-11