Incidental Mutation 'R0328:Skida1'
ID25822
Institutional Source Beutler Lab
Gene Symbol Skida1
Ensembl Gene ENSMUSG00000054074
Gene NameSKI/DACH domain containing 1
Synonyms
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18040676-18049051 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 18047186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066885] [ENSMUST00000091420] [ENSMUST00000142856] [ENSMUST00000152908]
Predicted Effect unknown
Transcript: ENSMUST00000066885
AA Change: D298G
SMART Domains Protein: ENSMUSP00000068520
Gene: ENSMUSG00000054074
AA Change: D298G

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.1e-19 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 262 279 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
coiled coil region 315 337 N/A INTRINSIC
Pfam:DUF4584 383 820 9.7e-162 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000091420
AA Change: D385G
SMART Domains Protein: ENSMUSP00000088982
Gene: ENSMUSG00000054074
AA Change: D385G

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 97 7.7e-17 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
SCOP:d1gkub1 224 254 3e-3 SMART
SCOP:d1gkub1 296 321 6e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 369 384 N/A INTRINSIC
coiled coil region 402 424 N/A INTRINSIC
Pfam:DUF4584 471 907 7.7e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142856
SMART Domains Protein: ENSMUSP00000122112
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.4e-20 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152908
SMART Domains Protein: ENSMUSP00000114785
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 65 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173604
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Skida1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Skida1 APN 2 18046005 unclassified probably benign
IGL03220:Skida1 APN 2 18048161 missense probably damaging 1.00
R0732:Skida1 UTSW 2 18046157 unclassified probably benign
R1239:Skida1 UTSW 2 18047317 unclassified probably benign
R1346:Skida1 UTSW 2 18048279 missense possibly damaging 0.92
R1597:Skida1 UTSW 2 18046332 unclassified probably benign
R1867:Skida1 UTSW 2 18046344 unclassified probably benign
R3797:Skida1 UTSW 2 18045897 nonsense probably null
R4521:Skida1 UTSW 2 18045872 unclassified probably benign
R5270:Skida1 UTSW 2 18047649 missense probably benign 0.03
R5467:Skida1 UTSW 2 18046112 unclassified probably benign
R5890:Skida1 UTSW 2 18046003 unclassified probably benign
R7181:Skida1 UTSW 2 18046791 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACTCGGTGGAAGAATCCTCCTC -3'
(R):5'- TGCTGCTGCCCAGATCCTACAAAG -3'

Sequencing Primer
(F):5'- GGAAGAATCCTCCTCCTCCG -3'
(R):5'- AGAGGTTTCATCTGGTCAACAGC -3'
Posted On2013-04-16