Incidental Mutation 'R0294:Mgst2'
ID26272
Institutional Source Beutler Lab
Gene Symbol Mgst2
Ensembl Gene ENSMUSG00000074604
Gene Namemicrosomal glutathione S-transferase 2
SynonymsMGST-II, GST2
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51660360-51682677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51681830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 88 (Y88C)
Ref Sequence ENSEMBL: ENSMUSP00000096705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099106] [ENSMUST00000118075] [ENSMUST00000121440] [ENSMUST00000159554] [ENSMUST00000161590]
Predicted Effect probably damaging
Transcript: ENSMUST00000099106
AA Change: Y88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096705
Gene: ENSMUSG00000074604
AA Change: Y88C

DomainStartEndE-ValueType
Pfam:MAPEG 8 124 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118075
SMART Domains Protein: ENSMUSP00000113677
Gene: ENSMUSG00000061143

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
coiled coil region 90 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121440
SMART Domains Protein: ENSMUSP00000112637
Gene: ENSMUSG00000061143

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 12 32 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
MamL-1 67 126 6.54e-30 SMART
low complexity region 436 454 N/A INTRINSIC
coiled coil region 459 502 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 621 647 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
coiled coil region 736 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159400
Predicted Effect probably benign
Transcript: ENSMUST00000159554
SMART Domains Protein: ENSMUSP00000141745
Gene: ENSMUSG00000074604

DomainStartEndE-ValueType
Pfam:MAPEG 8 80 3.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161230
Predicted Effect probably damaging
Transcript: ENSMUST00000161590
AA Change: I64M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125670
Gene: ENSMUSG00000074604
AA Change: I64M

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195423
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele display resistance to induced ER stress related cell death and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Mgst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Mgst2 APN 3 51682578 missense probably benign 0.00
IGL01712:Mgst2 APN 3 51664571 missense probably damaging 1.00
IGL03401:Mgst2 APN 3 51664512 missense possibly damaging 0.89
R2867:Mgst2 UTSW 3 51664533 synonymous silent
R4394:Mgst2 UTSW 3 51664528 missense probably damaging 1.00
R5149:Mgst2 UTSW 3 51682537 missense probably benign 0.02
R5878:Mgst2 UTSW 3 51661230 utr 5 prime probably benign
R6703:Mgst2 UTSW 3 51664612 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACTAACCAGCAGCTTGAGGACC -3'
(R):5'- GATTAGGAGTCCAAGTGCCTCCAAC -3'

Sequencing Primer
(F):5'- actggcacacttatttatcatactg -3'
(R):5'- ctcaatgaatcccaaacccac -3'
Posted On2013-04-16