Incidental Mutation 'R3508:Pck1'
ID267450
Institutional Source Beutler Lab
Gene Symbol Pck1
Ensembl Gene ENSMUSG00000027513
Gene Namephosphoenolpyruvate carboxykinase 1, cytosolic
SynonymsPEPCK, Pck-1
MMRRC Submission 040664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3508 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173153048-173159273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173158384 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 536 (V536A)
Ref Sequence ENSEMBL: ENSMUSP00000029017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029017
AA Change: V536A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029017
Gene: ENSMUSG00000027513
AA Change: V536A

DomainStartEndE-ValueType
Pfam:PEPCK 29 619 3.2e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151269
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a main control point for the regulation of gluconeogenesis. The cytosolic enzyme encoded by this gene, along with GTP, catalyzes the formation of phosphoenolpyruvate from oxaloacetate, with the release of carbon dioxide and GDP. The expression of this gene can be regulated by insulin, glucocorticoids, glucagon, cAMP, and diet. Defects in this gene are a cause of cytosolic phosphoenolpyruvate carboxykinase deficiency. A mitochondrial isozyme of the encoded protein also has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early postnatal lethality, decreased body fat, decreased glycogen levels in the liver, and altered blood chemistry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,505 Y500* probably null Het
Abca8a A T 11: 110,063,165 F816L probably benign Het
Adgrl3 C A 5: 81,724,256 N932K probably damaging Het
Apol8 T C 15: 77,749,443 E311G probably damaging Het
Atad2b G A 12: 4,950,595 probably null Het
Carmil1 A G 13: 24,019,676 probably benign Het
Cdc20b T C 13: 113,081,042 S332P possibly damaging Het
Cep162 A G 9: 87,231,977 probably null Het
Cfap54 T A 10: 92,885,424 S2482C unknown Het
Cnpy1 T C 5: 28,207,367 E107G probably damaging Het
Crtac1 C T 19: 42,304,741 V310I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Elmo1 T C 13: 20,605,232 I706T probably damaging Het
F12 T C 13: 55,421,059 T297A probably benign Het
Fanci A G 7: 79,433,472 I736V probably benign Het
Fbn1 T C 2: 125,306,327 N2667S probably benign Het
Flt4 T C 11: 49,634,114 S596P probably damaging Het
Fndc1 G A 17: 7,765,108 R1329* probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
H2-M10.1 T G 17: 36,325,614 R99S possibly damaging Het
Homer3 T A 8: 70,291,355 V243D probably benign Het
Hspa14 A G 2: 3,491,008 S437P probably damaging Het
Inpp1 A T 1: 52,799,391 I33N probably damaging Het
Ipo5 T A 14: 120,939,544 Y714N probably damaging Het
Kif27 T C 13: 58,313,212 E898G possibly damaging Het
Klhdc7b T A 15: 89,386,892 M1K probably null Het
Krt83 A G 15: 101,488,158 Y241H probably benign Het
Mfsd4b1 A G 10: 40,002,719 I394T probably benign Het
Micall1 A G 15: 79,122,765 D264G probably damaging Het
Mms22l T G 4: 24,586,224 D905E probably benign Het
Musk A G 4: 58,327,347 D217G probably damaging Het
Napb T C 2: 148,698,960 T236A probably benign Het
Nbn T A 4: 15,962,387 D38E probably damaging Het
Ncaph T C 2: 127,127,193 N87D probably benign Het
Olfr1251 A G 2: 89,667,472 V138A probably benign Het
Pcdhb13 T A 18: 37,443,151 V194E probably damaging Het
Pld5 C T 1: 175,994,037 G188S probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Pnkd A G 1: 74,350,634 T306A probably benign Het
Ppm1k T C 6: 57,514,990 E279G probably damaging Het
Ppm1l G T 3: 69,549,480 K243N possibly damaging Het
Ppp1r13b T C 12: 111,872,367 T26A probably damaging Het
Rtel1 T C 2: 181,322,409 V67A probably benign Het
Rxfp4 T C 3: 88,652,592 E184G probably damaging Het
Scp2d1 A G 2: 144,823,998 I86V probably benign Het
Sec16a G T 2: 26,425,850 P1718Q probably damaging Het
Sgcg T A 14: 61,221,746 T245S probably benign Het
Slc18a2 A G 19: 59,273,557 T215A probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sox17 G T 1: 4,492,155 P146Q probably damaging Het
Sybu T A 15: 44,673,082 E616V probably damaging Het
Tk2 C T 8: 104,231,193 V174I probably benign Het
Tmc5 G A 7: 118,645,395 V499I probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tonsl T C 15: 76,639,756 T15A probably benign Het
Ttll12 A G 15: 83,580,630 I448T probably damaging Het
Ttn A G 2: 76,753,757 S22336P probably damaging Het
Ubap1 C A 4: 41,379,163 H126N probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vmn2r84 T C 10: 130,390,908 N354D probably damaging Het
Vpreb3 A C 10: 75,949,203 H45P probably benign Het
Zc3h13 T A 14: 75,308,940 Y160* probably null Het
Other mutations in Pck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Pck1 APN 2 173154118 critical splice donor site probably null
IGL00817:Pck1 APN 2 173153432 missense possibly damaging 0.47
IGL02476:Pck1 APN 2 173158282 missense probably benign
IGL02803:Pck1 APN 2 173156004 missense probably damaging 1.00
IGL02874:Pck1 APN 2 173155249 missense probably damaging 1.00
IGL02886:Pck1 APN 2 173154856 missense probably benign 0.43
R0041:Pck1 UTSW 2 173155210 missense probably benign 0.21
R0125:Pck1 UTSW 2 173156081 nonsense probably null
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0373:Pck1 UTSW 2 173153390 start codon destroyed probably null 0.99
R0595:Pck1 UTSW 2 173157029 missense probably damaging 1.00
R1338:Pck1 UTSW 2 173158410 missense probably benign 0.18
R1623:Pck1 UTSW 2 173154718 missense probably benign 0.26
R1752:Pck1 UTSW 2 173157113 missense probably benign 0.00
R2107:Pck1 UTSW 2 173154068 missense probably benign 0.00
R2376:Pck1 UTSW 2 173157116 missense probably benign
R2883:Pck1 UTSW 2 173158575 missense probably benign 0.03
R4718:Pck1 UTSW 2 173155221 missense probably damaging 0.99
R4853:Pck1 UTSW 2 173154714 nonsense probably null
R4907:Pck1 UTSW 2 173157023 missense probably damaging 1.00
R4950:Pck1 UTSW 2 173154827 missense probably benign
R5073:Pck1 UTSW 2 173156977 missense probably benign 0.41
R5134:Pck1 UTSW 2 173153489 missense probably benign 0.23
R5213:Pck1 UTSW 2 173156085 nonsense probably null
R5244:Pck1 UTSW 2 173154863 missense possibly damaging 0.91
R5654:Pck1 UTSW 2 173158560 missense probably damaging 1.00
R5831:Pck1 UTSW 2 173156999 missense probably damaging 1.00
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6143:Pck1 UTSW 2 173154012 missense probably damaging 0.99
R6276:Pck1 UTSW 2 173157319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGCACGACCCCTTTG -3'
(R):5'- CAATTTCGTAAGGGAGGTCGG -3'

Sequencing Primer
(F):5'- GACCCCTTTGCCATGCGAC -3'
(R):5'- GGTCCTCCAGATACCTGTCG -3'
Posted On2015-02-18