Incidental Mutation 'R3693:Ces2e'
ID268862
Institutional Source Beutler Lab
Gene Symbol Ces2e
Ensembl Gene ENSMUSG00000031886
Gene Namecarboxylesterase 2E
Synonyms9030624L02Rik, Ces5
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104926260-104934672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104928811 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000105037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034355] [ENSMUST00000109410]
Predicted Effect probably damaging
Transcript: ENSMUST00000034355
AA Change: D122G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886
AA Change: D122G

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109410
AA Change: D122G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105037
Gene: ENSMUSG00000031886
AA Change: D122G

DomainStartEndE-ValueType
Pfam:COesterase 9 538 1.7e-171 PFAM
Pfam:Abhydrolase_3 143 246 6.6e-11 PFAM
Pfam:Peptidase_S9 158 276 2.1e-7 PFAM
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Ces2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Ces2e APN 8 104929565 missense probably benign 0.42
IGL02045:Ces2e APN 8 104930658 splice site probably benign
IGL02656:Ces2e APN 8 104927056 missense possibly damaging 0.94
IGL02904:Ces2e APN 8 104931338 missense probably benign
IGL02972:Ces2e APN 8 104927061 missense probably damaging 1.00
IGL03244:Ces2e APN 8 104928819 missense probably benign 0.38
R0585:Ces2e UTSW 8 104929821 missense probably damaging 1.00
R0762:Ces2e UTSW 8 104929864 missense probably damaging 0.98
R1004:Ces2e UTSW 8 104929738 missense probably damaging 1.00
R1168:Ces2e UTSW 8 104927014 missense possibly damaging 0.49
R1731:Ces2e UTSW 8 104929576 missense probably damaging 1.00
R2134:Ces2e UTSW 8 104932539 critical splice donor site probably null
R3087:Ces2e UTSW 8 104930715 missense probably benign 0.18
R4622:Ces2e UTSW 8 104928709 intron probably null
R4873:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4875:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4965:Ces2e UTSW 8 104933698 missense probably benign 0.09
R5365:Ces2e UTSW 8 104927214 critical splice donor site probably null
R5529:Ces2e UTSW 8 104929911 missense probably benign 0.00
R5601:Ces2e UTSW 8 104929494 missense probably benign 0.42
R5968:Ces2e UTSW 8 104932995 missense probably damaging 1.00
R6128:Ces2e UTSW 8 104928796 missense probably benign 0.03
Z1088:Ces2e UTSW 8 104931347 missense probably benign
Z1088:Ces2e UTSW 8 104932398 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGCAGGACAACTTGGAGG -3'
(R):5'- AGTGTTCAGCTGCCAATTGTG -3'

Sequencing Primer
(F):5'- CAACTTGGAGGGAAGTGGC -3'
(R):5'- CAGCTGCCAATTGTGGGTAAG -3'
Posted On2015-02-19