Incidental Mutation 'R3610:Acsf2'
List [record 1 of 20] next >> last >|
ID269208
Institutional Source Beutler Lab
Gene Symbol Acsf2
Ensembl Gene ENSMUSG00000076435
Gene Nameacyl-CoA synthetase family member 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3610 (G1)
Quality Score167
Status Not validated
Chromosome11
Chromosomal Location94557102-94601871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94561346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 457 (V457L)
Ref Sequence ENSEMBL: ENSMUSP00000099453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040418] [ENSMUST00000103164]
Predicted Effect probably benign
Transcript: ENSMUST00000040418
SMART Domains Protein: ENSMUSP00000047844
Gene: ENSMUSG00000039084

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 21 54 1.7e-7 SMART
LRR_TYP 73 96 9.58e-3 SMART
LRR_TYP 97 120 1.45e-2 SMART
LRR_TYP 121 144 1.69e-3 SMART
LRR_TYP 145 168 6.42e-4 SMART
LRR 170 192 2.2e1 SMART
LRR 193 216 2.14e1 SMART
LRR_TYP 217 240 4.17e-3 SMART
LRR 245 265 2.27e2 SMART
LRR 266 289 3.36e1 SMART
LRRCT 299 346 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103164
AA Change: V457L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435
AA Change: V457L

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131808
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Acsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Acsf2 APN 11 94570450 missense probably benign 0.00
IGL02218:Acsf2 APN 11 94601763 missense probably benign 0.00
IGL02602:Acsf2 APN 11 94570465 splice site probably benign
R0047:Acsf2 UTSW 11 94569342 missense probably benign 0.01
R0194:Acsf2 UTSW 11 94561370 missense probably benign 0.00
R1400:Acsf2 UTSW 11 94570316 missense probably benign 0.07
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1512:Acsf2 UTSW 11 94561398 splice site probably benign
R2007:Acsf2 UTSW 11 94571640 missense possibly damaging 0.88
R2271:Acsf2 UTSW 11 94558873 nonsense probably null
R4447:Acsf2 UTSW 11 94569359 missense possibly damaging 0.68
R4717:Acsf2 UTSW 11 94559546 missense probably benign 0.02
R4857:Acsf2 UTSW 11 94569338 missense probably benign 0.07
R4974:Acsf2 UTSW 11 94569329 missense possibly damaging 0.77
R5090:Acsf2 UTSW 11 94571269 critical splice donor site probably null
R5185:Acsf2 UTSW 11 94562911 missense probably damaging 1.00
R5732:Acsf2 UTSW 11 94569942 unclassified probably benign
R5797:Acsf2 UTSW 11 94571679 missense probably damaging 0.98
R5872:Acsf2 UTSW 11 94573149 missense probably benign 0.16
R6350:Acsf2 UTSW 11 94558330 missense probably benign 0.12
R6903:Acsf2 UTSW 11 94559591 missense probably benign 0.03
R6912:Acsf2 UTSW 11 94570380 missense probably benign
R7336:Acsf2 UTSW 11 94571650 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAAGTCTCATGGTCAAGGGG -3'
(R):5'- CAGCTTCATTTCTGAGAGGGTG -3'

Sequencing Primer
(F):5'- TCTCATGGTCAAGGGGGATCC -3'
(R):5'- CTTCATTTCTGAGAGGGTGAAGGAG -3'
Posted On2015-02-19