Incidental Mutation 'R3782:Gm7075'
ID272088
Institutional Source Beutler Lab
Gene Symbol Gm7075
Ensembl Gene ENSMUSG00000048185
Gene Namepredicted gene 7075
Synonyms
MMRRC Submission 040751-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R3782 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63421365-63421789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63421693 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 16 (H16L)
Ref Sequence ENSEMBL: ENSMUSP00000097258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054760]
Predicted Effect probably benign
Transcript: ENSMUST00000054760
AA Change: H16L

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097258
Gene: ENSMUSG00000048185
AA Change: H16L

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
RING 60 101 2.74e-2 SMART
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 T A 5: 143,906,699 K24N possibly damaging Het
Atf6 A T 1: 170,794,767 Y428* probably null Het
BC034090 T C 1: 155,226,278 E80G probably damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cpsf3 A C 12: 21,300,066 E262A possibly damaging Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dlg5 A G 14: 24,190,310 probably benign Het
Enam A T 5: 88,502,815 S653C probably damaging Het
Fndc3b A T 3: 27,459,986 V682D possibly damaging Het
Guf1 A T 5: 69,567,152 M396L probably benign Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpgd G A 8: 56,298,418 V94M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama5 T G 2: 180,194,563 H1165P possibly damaging Het
Lrrfip1 A G 1: 91,112,189 T205A possibly damaging Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Mpp7 A T 18: 7,351,085 H537Q probably damaging Het
Mx1 T C 16: 97,451,995 D380G possibly damaging Het
Nckap5 T A 1: 126,025,074 Q1183L possibly damaging Het
Nkx1-2 A G 7: 132,597,432 V200A probably damaging Het
Nr3c2 T A 8: 77,085,684 probably null Het
Nsmce1 C T 7: 125,486,377 V47I probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1009 G A 2: 85,721,696 C97Y probably damaging Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Phactr4 A T 4: 132,367,867 probably null Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Spta1 A T 1: 174,208,314 Y1062F probably damaging Het
Ssc5d A G 7: 4,942,791 T941A probably benign Het
Taf11 A G 17: 27,903,193 probably benign Het
Tax1bp1 A G 6: 52,739,548 H286R probably damaging Het
Tmem62 T A 2: 120,977,467 W57R probably damaging Het
Vmn2r111 T C 17: 22,571,320 Y235C possibly damaging Het
Vmn2r22 T A 6: 123,650,632 K2* probably null Het
Vmn2r74 A G 7: 85,956,114 V442A probably benign Het
Other mutations in Gm7075
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Gm7075 UTSW 10 63421602 nonsense probably null
R1550:Gm7075 UTSW 10 63421648 missense probably damaging 1.00
R4729:Gm7075 UTSW 10 63421465 missense probably damaging 1.00
R5325:Gm7075 UTSW 10 63421679 missense probably benign
R5409:Gm7075 UTSW 10 63421624 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGAATGGTTACACTCTCCCCAG -3'
(R):5'- CAGTGTGAGTTCCAGGACAG -3'

Sequencing Primer
(F):5'- GACCACGACACAGTCCTTTTG -3'
(R):5'- GCTACACAGAGGATCCCTGTC -3'
Posted On2015-03-25