Incidental Mutation 'R3824:Olfr1394'
ID275291
Institutional Source Beutler Lab
Gene Symbol Olfr1394
Ensembl Gene ENSMUSG00000048378
Gene Nameolfactory receptor 1394
SynonymsMOR280-1, GA_x6K02T2QP88-6274566-6273628
MMRRC Submission 040885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3824 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49154377-49162854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49160793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 260 (S260G)
Ref Sequence ENSEMBL: ENSMUSP00000149520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000052668] [ENSMUST00000216273]
Predicted Effect probably benign
Transcript: ENSMUST00000046522
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052668
AA Change: S260G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063062
Gene: ENSMUSG00000048378
AA Change: S260G

DomainStartEndE-ValueType
Pfam:7tm_4 30 309 6.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 37 233 3e-5 PFAM
Pfam:7tm_1 43 292 2.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216273
AA Change: S260G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,611 C20R probably benign Het
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
9430015G10Rik T A 4: 156,119,150 probably null Het
A2ml1 A G 6: 128,568,763 V467A probably damaging Het
Abcc3 T C 11: 94,368,620 probably null Het
Acad10 A T 5: 121,622,818 M941K probably benign Het
Agrn A G 4: 156,169,302 L1649P probably damaging Het
Arhgap12 T C 18: 6,061,930 R402G possibly damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Btn2a2 T A 13: 23,480,465 T308S probably benign Het
C8b G T 4: 104,783,009 A170S probably benign Het
Cabyr T A 18: 12,751,690 D411E probably benign Het
Capn3 T C 2: 120,484,483 probably benign Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Cflar T A 1: 58,735,697 Y218N probably benign Het
Col11a2 T C 17: 34,054,180 Y630H probably damaging Het
Coq6 T C 12: 84,372,415 probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fam205c A G 4: 42,873,492 probably null Het
Fry T A 5: 150,496,419 S1015R possibly damaging Het
Gjb4 A G 4: 127,351,429 S240P probably benign Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gls A C 1: 52,232,988 M2R possibly damaging Het
Gm13078 A T 4: 143,726,685 H121L probably benign Het
Gm5724 T C 6: 141,754,374 Q144R possibly damaging Het
Gm906 G A 13: 50,245,512 S926F possibly damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Ints8 A T 4: 11,225,621 Y645* probably null Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kat8 T A 7: 127,924,482 D292E possibly damaging Het
Myo19 T A 11: 84,885,679 C54S probably damaging Het
Myo5b C T 18: 74,661,655 H532Y probably benign Het
Nckap1 T C 2: 80,540,560 K357E possibly damaging Het
Ndufaf1 C T 2: 119,660,271 V105M probably benign Het
Olfr1076 T G 2: 86,509,023 L188R possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Olfr904 T A 9: 38,464,526 C162S probably benign Het
Palld T C 8: 61,709,033 D439G probably damaging Het
Pcf11 T C 7: 92,659,620 probably benign Het
Pigo A T 4: 43,020,909 W678R possibly damaging Het
Pip5kl1 A T 2: 32,583,271 probably null Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Prom2 A G 2: 127,535,673 probably benign Het
Ptk7 A G 17: 46,565,378 I1049T probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Ptprm A G 17: 66,809,575 V894A probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sdk1 A G 5: 141,936,049 T267A probably benign Het
Sorcs3 T A 19: 48,722,956 D653E probably damaging Het
St8sia1 A G 6: 142,829,025 L276P probably damaging Het
Sync T C 4: 129,294,363 V396A possibly damaging Het
Taok3 A G 5: 117,255,937 T592A probably benign Het
Tas2r104 T A 6: 131,685,039 I236F possibly damaging Het
Tas2r107 A C 6: 131,659,330 I252S probably benign Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Usp24 G A 4: 106,379,066 V984I probably benign Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn1r2 A T 4: 3,172,413 T111S probably damaging Het
Vmn2r74 T G 7: 85,958,258 N86H probably damaging Het
Zfp12 T C 5: 143,240,322 V72A probably benign Het
Other mutations in Olfr1394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr1394 APN 11 49160674 missense probably damaging 1.00
IGL01603:Olfr1394 APN 11 49160611 missense probably damaging 1.00
IGL01736:Olfr1394 APN 11 49160527 missense probably damaging 1.00
IGL02246:Olfr1394 APN 11 49160094 missense probably benign 0.44
IGL02321:Olfr1394 APN 11 49160775 missense probably damaging 1.00
IGL03405:Olfr1394 APN 11 49160886 unclassified probably null
R0358:Olfr1394 UTSW 11 49160244 missense probably benign 0.00
R1967:Olfr1394 UTSW 11 49160848 missense probably benign 0.06
R2472:Olfr1394 UTSW 11 49160371 missense possibly damaging 0.76
R4105:Olfr1394 UTSW 11 49160548 missense possibly damaging 0.51
R4255:Olfr1394 UTSW 11 49160435 nonsense probably null
R4716:Olfr1394 UTSW 11 49160890 missense probably damaging 1.00
R5545:Olfr1394 UTSW 11 49160626 missense probably damaging 1.00
R6894:Olfr1394 UTSW 11 49160359 missense probably benign 0.06
R6999:Olfr1394 UTSW 11 49160412 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTCCTGTGCAGACACCTCAC -3'
(R):5'- AGTCCTACCTAGCCAGAGAGG -3'

Sequencing Primer
(F):5'- AGGACCTCATCTATGCATGTTG -3'
(R):5'- CCCAAAAGGCATAGAGGAAGCATTG -3'
Posted On2015-04-02