Incidental Mutation 'R3922:1700012B07Rik'
ID306990
Institutional Source Beutler Lab
Gene Symbol 1700012B07Rik
Ensembl Gene ENSMUSG00000020617
Gene NameRIKEN cDNA 1700012B07 gene
Synonyms
MMRRC Submission 040819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.021) question?
Stock #R3922 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109787651-109828046 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 109794154 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Ref Sequence ENSEMBL: ENSMUSP00000102285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]
Predicted Effect probably null
Transcript: ENSMUST00000020941
AA Change: C172*
SMART Domains Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106674
AA Change: C172*
SMART Domains Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143578
SMART Domains Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

DomainStartEndE-ValueType
low complexity region 33 38 N/A INTRINSIC
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147006
Meta Mutation Damage Score 0.6404 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,480,560 E432V probably benign Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Arhgef28 A G 13: 97,993,944 L462P possibly damaging Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cep70 T A 9: 99,275,579 *117R probably null Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Cntrl A G 2: 35,129,739 E526G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Eea1 T A 10: 96,036,633 N1068K probably benign Het
Egfr T A 11: 16,881,495 C555S probably damaging Het
Esd A T 14: 74,743,227 Q130H probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Gpr89 A T 3: 96,890,899 I147N probably damaging Het
H2-M10.1 T A 17: 36,325,685 I76L probably benign Het
Lgi4 A T 7: 31,067,448 D300V probably benign Het
Lrp1b C A 2: 40,677,581 V276L unknown Het
Lrp2 T C 2: 69,506,376 K1351E probably benign Het
Mroh8 T C 2: 157,222,811 I782V probably benign Het
Msrb1 T C 17: 24,740,083 S70P probably damaging Het
Nek10 T C 14: 14,861,585 M547T possibly damaging Het
Olfr1501 T C 19: 13,838,766 T136A probably damaging Het
Olfr615 T C 7: 103,560,705 V76A probably benign Het
Olfr769 C A 10: 129,111,613 V271F possibly damaging Het
P4htm T C 9: 108,582,895 N227D probably benign Het
Plekhm2 T C 4: 141,629,532 T787A probably benign Het
Pramel5 A G 4: 144,273,052 L155P probably damaging Het
Sbno1 T C 5: 124,381,930 Y1122C probably damaging Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Sft2d1 G T 17: 8,318,882 L34F possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slc27a3 G T 3: 90,387,085 H460N possibly damaging Het
Slc35g2 A T 9: 100,552,727 I297N probably benign Het
Ssh1 T G 5: 113,942,708 Q865P possibly damaging Het
Trp63 A G 16: 25,889,009 D583G probably damaging Het
Usp28 T C 9: 49,030,923 probably null Het
Wdr43 A G 17: 71,638,301 probably benign Het
Zfhx4 A G 3: 5,400,647 Y1955C probably damaging Het
Zfp108 G A 7: 24,261,348 G455R probably damaging Het
Zfp353-ps A T 8: 42,083,012 noncoding transcript Het
Other mutations in 1700012B07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:1700012B07Rik APN 11 109794111 missense probably damaging 0.99
IGL03006:1700012B07Rik APN 11 109827845 missense probably damaging 0.98
R0626:1700012B07Rik UTSW 11 109788721 unclassified probably benign
R1566:1700012B07Rik UTSW 11 109788806 missense probably benign 0.01
R1654:1700012B07Rik UTSW 11 109797399 missense probably benign 0.36
R2373:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2405:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2410:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2411:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3707:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3708:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3732:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3745:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3783:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3784:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3785:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3805:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3806:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3926:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4085:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4089:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4110:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4111:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4112:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4171:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4506:1700012B07Rik UTSW 11 109794261 missense probably damaging 1.00
R4825:1700012B07Rik UTSW 11 109791672 missense probably benign 0.00
R5032:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5033:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5971:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6078:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6079:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6138:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6354:1700012B07Rik UTSW 11 109794216 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATTCCTCTGTAGATAATGAGTCCGG -3'
(R):5'- GCTTGTCTAACGAAGCACCC -3'

Sequencing Primer
(F):5'- TCCGGAGAATAGATGCTTGCCAATC -3'
(R):5'- ACCCATGCAAACTGGTCCTTTG -3'
Posted On2015-04-17