Incidental Mutation 'R4110:1700012B07Rik'
ID317264
Institutional Source Beutler Lab
Gene Symbol 1700012B07Rik
Ensembl Gene ENSMUSG00000020617
Gene NameRIKEN cDNA 1700012B07 gene
Synonyms
MMRRC Submission 040988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.021) question?
Stock #R4110 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109787651-109828046 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 109794154 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Ref Sequence ENSEMBL: ENSMUSP00000102285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]
Predicted Effect probably null
Transcript: ENSMUST00000020941
AA Change: C172*
SMART Domains Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106674
AA Change: C172*
SMART Domains Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143578
SMART Domains Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

DomainStartEndE-ValueType
low complexity region 33 38 N/A INTRINSIC
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147006
Meta Mutation Damage Score 0.6404 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 A T 15: 20,666,526 L43Q probably damaging Het
Alms1 G A 6: 85,620,888 V1368I probably benign Het
Als2cl T C 9: 110,884,047 S2P probably benign Het
AW209491 T C 13: 14,637,573 V337A probably damaging Het
Bace2 A G 16: 97,436,656 T436A probably benign Het
BC023105 A G 18: 60,442,284 noncoding transcript Het
Blvra T C 2: 127,095,155 V176A probably damaging Het
Casp2 G A 6: 42,267,894 A76T probably damaging Het
Ccdc88c A G 12: 100,945,073 L34P probably damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a2 T A 10: 76,606,169 probably null Het
Cse1l T C 2: 166,942,050 Y488H probably benign Het
Dip2c G T 13: 9,637,101 G1254C probably damaging Het
Dnajb12 T A 10: 59,894,314 S270R possibly damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dscaml1 G A 9: 45,732,068 A1262T probably benign Het
Dtwd2 A C 18: 49,698,306 probably benign Het
Fadd C A 7: 144,580,751 K132N possibly damaging Het
Fndc3c1 T C X: 106,444,291 N462S probably benign Het
Fzd3 A G 14: 65,235,167 V384A probably benign Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Gm853 A T 4: 130,219,174 L143Q probably damaging Het
Gsdmc T A 15: 63,780,027 H245L probably benign Het
H13 T C 2: 152,681,109 I114T probably damaging Het
Hhipl2 A G 1: 183,424,012 R78G probably benign Het
Hrh3 C A 2: 180,102,850 R99L possibly damaging Het
Man2c1 A G 9: 57,136,771 N330S probably damaging Het
Muc19 T A 15: 91,897,622 noncoding transcript Het
Myh14 T G 7: 44,628,550 M1092L probably benign Het
Neb A G 2: 52,148,766 I2899T probably benign Het
Neb T A 2: 52,244,125 Q3282L probably damaging Het
Nqo2 A T 13: 33,979,637 Q93L probably benign Het
Olfr1239 C A 2: 89,418,100 L104F probably benign Het
Olfr46 C A 7: 140,610,264 L33M probably benign Het
Olfr46 T A 7: 140,610,265 L33Q possibly damaging Het
Olfr641 T C 7: 104,040,402 V202A probably damaging Het
Pcsk1 A G 13: 75,096,369 N122S probably damaging Het
Pdzrn4 A G 15: 92,770,864 I966V probably benign Het
Phldb1 G A 9: 44,715,831 T439I possibly damaging Het
Pign A G 1: 105,553,815 probably benign Het
Pkn1 A T 8: 83,691,199 D120E probably benign Het
Ptpru A G 4: 131,819,037 Y301H probably damaging Het
Raly C T 2: 154,857,458 Q61* probably null Het
Rpl24 T C 16: 55,971,360 V148A probably benign Het
S100a16 A G 3: 90,542,072 N18S probably damaging Het
Sec31b G T 19: 44,524,529 T507N possibly damaging Het
Sgca T C 11: 94,972,570 T27A possibly damaging Het
Slc22a12 C A 19: 6,540,628 R203L probably damaging Het
Ssbp3 C A 4: 107,047,196 probably benign Het
Sucnr1 C G 3: 60,086,794 R248G probably damaging Het
Tbr1 C T 2: 61,811,732 P184L probably benign Het
Thsd7b A T 1: 130,116,619 D1112V probably benign Het
Tnc A G 4: 64,014,951 V692A probably damaging Het
Top2a C A 11: 99,022,960 K18N probably damaging Het
Topbp1 G T 9: 103,309,959 R121L probably damaging Het
Unc79 T C 12: 103,059,370 C339R probably damaging Het
Wdfy3 C T 5: 101,900,058 probably null Het
Zbtb3 G C 19: 8,803,020 probably benign Het
Zfp715 T A 7: 43,297,880 K885N possibly damaging Het
Other mutations in 1700012B07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:1700012B07Rik APN 11 109794111 missense probably damaging 0.99
IGL03006:1700012B07Rik APN 11 109827845 missense probably damaging 0.98
R0626:1700012B07Rik UTSW 11 109788721 unclassified probably benign
R1566:1700012B07Rik UTSW 11 109788806 missense probably benign 0.01
R1654:1700012B07Rik UTSW 11 109797399 missense probably benign 0.36
R2373:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2405:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2410:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2411:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3707:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3708:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3732:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3745:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3783:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3784:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3785:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3805:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3806:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3922:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3926:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4085:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4089:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4111:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4112:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4171:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4506:1700012B07Rik UTSW 11 109794261 missense probably damaging 1.00
R4825:1700012B07Rik UTSW 11 109791672 missense probably benign 0.00
R5032:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5033:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5971:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6078:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6079:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6138:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6354:1700012B07Rik UTSW 11 109794216 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTCCTCTGTAGATAATGAGTCCGG -3'
(R):5'- AGCTTGTCTAACGAAGCACCC -3'

Sequencing Primer
(F):5'- TCCGGAGAATAGATGCTTGCCAATC -3'
(R):5'- ACCCATGCAAACTGGTCCTTTG -3'
Posted On2015-05-15