Incidental Mutation 'R3923:Onecut2'
ID307064
Institutional Source Beutler Lab
Gene Symbol Onecut2
Ensembl Gene ENSMUSG00000045991
Gene Nameone cut domain, family member 2
SynonymsOc2, OC-2
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R3923 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64340364-64398488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64341520 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 381 (K381E)
Ref Sequence ENSEMBL: ENSMUSP00000110798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115145] [ENSMUST00000175965]
Predicted Effect probably damaging
Transcript: ENSMUST00000115145
AA Change: K381E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110798
Gene: ENSMUSG00000045991
AA Change: K381E

DomainStartEndE-ValueType
low complexity region 34 56 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
low complexity region 167 185 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
CUT 326 411 1e-42 SMART
HOX 427 489 2.63e-12 SMART
low complexity region 491 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175965
AA Change: K362E

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135692
Gene: ENSMUSG00000045991
AA Change: K362E

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
low complexity region 127 139 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
CUT 307 392 1e-42 SMART
HOX 408 470 2.63e-12 SMART
low complexity region 472 482 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the onecut family of transcription factors, which are characterized by a cut domain and an atypical homeodomain. The protein binds to specific DNA sequences and stimulates expression of target genes, including genes involved in melanocyte and hepatocyte differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormal bile duct development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hdgf T A 3: 87,914,228 D128E probably benign Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Onecut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Onecut2 APN 18 64341089 missense probably damaging 1.00
IGL01712:Onecut2 APN 18 64386602 missense probably damaging 0.97
IGL01925:Onecut2 APN 18 64341514 missense probably damaging 1.00
IGL03105:Onecut2 APN 18 64341508 nonsense probably null
R0197:Onecut2 UTSW 18 64341472 missense possibly damaging 0.91
R0504:Onecut2 UTSW 18 64340749 missense possibly damaging 0.72
R1514:Onecut2 UTSW 18 64341580 missense possibly damaging 0.93
R2314:Onecut2 UTSW 18 64341197 missense probably damaging 0.99
R3924:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R3925:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R4888:Onecut2 UTSW 18 64340927 missense possibly damaging 0.86
R5818:Onecut2 UTSW 18 64340975 missense possibly damaging 0.76
R5995:Onecut2 UTSW 18 64341548 missense probably damaging 0.99
R7132:Onecut2 UTSW 18 64340912 missense possibly damaging 0.79
R7232:Onecut2 UTSW 18 64341562 missense probably damaging 1.00
R7250:Onecut2 UTSW 18 64386440 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AATGGCTTACACCACCCTGG -3'
(R):5'- ACTGGCAATGAAAACTCAGAGTC -3'

Sequencing Primer
(F):5'- CTCCTCGGGTTCTCAGGTG -3'
(R):5'- AACTCAGAGTCAAGGAGTGTG -3'
Posted On2015-04-17