Incidental Mutation 'R3903:Golm1'
ID309274
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Namegolgi membrane protein 1
Synonyms2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2
MMRRC Submission 040907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3903 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59634626-59675811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59638340 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 346 (Q346R)
Ref Sequence ENSEMBL: ENSMUSP00000093410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000022039] [ENSMUST00000095739]
Predicted Effect probably benign
Transcript: ENSMUST00000022038
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022039
AA Change: Q346R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: Q346R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095739
AA Change: Q346R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: Q346R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172118
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Ap3m1 T C 14: 21,036,664 Y185C probably null Het
Calcrl T A 2: 84,368,642 probably benign Het
Ccdc178 C T 18: 22,023,095 V573I possibly damaging Het
Cdh6 T C 15: 13,042,575 K499R probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Cyp4f40 C A 17: 32,659,624 R47S possibly damaging Het
Eif4a2 AG A 16: 23,110,640 probably null Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Gm8180 T A 14: 43,783,635 R39W probably null Het
Grap T G 11: 61,660,325 probably null Het
Hormad2 A G 11: 4,427,237 probably benign Het
Hyal1 T C 9: 107,578,972 probably null Het
Kif12 A G 4: 63,167,976 V378A possibly damaging Het
Lrrk2 A T 15: 91,747,700 S1276C probably damaging Het
Lrrk2 G A 15: 91,747,701 S1276N probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1276 A T 2: 111,257,769 Y218F probably damaging Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr898 C T 9: 38,349,658 Q186* probably null Het
Pabpc6 T C 17: 9,669,154 E156G probably benign Het
Rorb A G 19: 18,962,099 Y155H probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Scn1a A G 2: 66,318,132 I3T probably benign Het
Serpinb9 T C 13: 33,010,810 M183T possibly damaging Het
Wnk1 A G 6: 119,949,051 S1151P probably damaging Het
Xirp2 C T 2: 67,508,036 T207I probably benign Het
Zfp39 T C 11: 58,890,175 Y587C probably benign Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59649656 missense probably damaging 0.99
IGL01327:Golm1 APN 13 59645144 missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59638377 missense probably benign 0.00
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0458:Golm1 UTSW 13 59664364 missense probably damaging 0.98
R0989:Golm1 UTSW 13 59640183 missense probably benign 0.01
R1301:Golm1 UTSW 13 59638373 missense probably damaging 0.99
R1804:Golm1 UTSW 13 59642389 critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59642251 missense probably benign 0.04
R1940:Golm1 UTSW 13 59642237 splice site probably benign
R2086:Golm1 UTSW 13 59645185 nonsense probably null
R2513:Golm1 UTSW 13 59642258 missense probably benign 0.01
R2887:Golm1 UTSW 13 59640230 missense probably benign 0.00
R4154:Golm1 UTSW 13 59642353 missense probably benign 0.01
R5580:Golm1 UTSW 13 59642365 missense probably benign 0.03
R6193:Golm1 UTSW 13 59645158 missense probably benign 0.00
R6418:Golm1 UTSW 13 59665561 missense probably damaging 1.00
R6594:Golm1 UTSW 13 59664227 missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59638383 missense probably damaging 1.00
R6967:Golm1 UTSW 13 59649576 small deletion probably benign
R6968:Golm1 UTSW 13 59649576 small deletion probably benign
R6991:Golm1 UTSW 13 59649576 small deletion probably benign
R6992:Golm1 UTSW 13 59649576 small deletion probably benign
R6993:Golm1 UTSW 13 59649576 small deletion probably benign
R6996:Golm1 UTSW 13 59642244 missense probably benign 0.00
X0026:Golm1 UTSW 13 59638313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATTTCTGGGACACCTTTGC -3'
(R):5'- ACTCGCCATGGCATTTGTATTG -3'

Sequencing Primer
(F):5'- GGGACACCTTTGCTCTAACC -3'
(R):5'- CAGTCAGGCTACTTTCTGAGGTACAG -3'
Posted On2015-04-17