Incidental Mutation 'R3903:Hyal1'
ID309264
Institutional Source Beutler Lab
Gene Symbol Hyal1
Ensembl Gene ENSMUSG00000010051
Gene Namehyaluronoglucosaminidase 1
SynonymsHyal-1
MMRRC Submission 040907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3903 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107576927-107581710 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 107578972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000144392] [ENSMUST00000148440] [ENSMUST00000149638]
Predicted Effect probably null
Transcript: ENSMUST00000010195
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112387
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122985
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123005
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127380
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130053
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139581
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144392
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184695
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a progressive osteoarthritis associated with bony outgrowths, early loss of articular cartilage proteoglycans and accumulation of hyaluronan (HA) in the cartilage of knee joints, but show no signs of non-skeletal tissue GAG accumulation or increased serum HA levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Ap3m1 T C 14: 21,036,664 Y185C probably null Het
Calcrl T A 2: 84,368,642 probably benign Het
Ccdc178 C T 18: 22,023,095 V573I possibly damaging Het
Cdh6 T C 15: 13,042,575 K499R probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Cyp4f40 C A 17: 32,659,624 R47S possibly damaging Het
Eif4a2 AG A 16: 23,110,640 probably null Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Gm8180 T A 14: 43,783,635 R39W probably null Het
Golm1 T C 13: 59,638,340 Q346R probably damaging Het
Grap T G 11: 61,660,325 probably null Het
Hormad2 A G 11: 4,427,237 probably benign Het
Kif12 A G 4: 63,167,976 V378A possibly damaging Het
Lrrk2 A T 15: 91,747,700 S1276C probably damaging Het
Lrrk2 G A 15: 91,747,701 S1276N probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1276 A T 2: 111,257,769 Y218F probably damaging Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr898 C T 9: 38,349,658 Q186* probably null Het
Pabpc6 T C 17: 9,669,154 E156G probably benign Het
Rorb A G 19: 18,962,099 Y155H probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Scn1a A G 2: 66,318,132 I3T probably benign Het
Serpinb9 T C 13: 33,010,810 M183T possibly damaging Het
Wnk1 A G 6: 119,949,051 S1151P probably damaging Het
Xirp2 C T 2: 67,508,036 T207I probably benign Het
Zfp39 T C 11: 58,890,175 Y587C probably benign Het
Other mutations in Hyal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Hyal1 APN 9 107579139 missense probably damaging 1.00
IGL02265:Hyal1 APN 9 107577908 missense probably benign 0.03
R0043:Hyal1 UTSW 9 107579320 missense probably benign 0.15
R0727:Hyal1 UTSW 9 107578402 missense possibly damaging 0.71
R1497:Hyal1 UTSW 9 107577995 unclassified probably null
R1499:Hyal1 UTSW 9 107577892 missense probably damaging 1.00
R4662:Hyal1 UTSW 9 107579221 missense probably damaging 1.00
R4977:Hyal1 UTSW 9 107578954 missense probably benign 0.19
R5122:Hyal1 UTSW 9 107578069 missense probably benign 0.00
R5781:Hyal1 UTSW 9 107577667 missense probably damaging 1.00
R6142:Hyal1 UTSW 9 107579374 missense probably benign 0.00
R6651:Hyal1 UTSW 9 107579371 missense probably damaging 1.00
R6945:Hyal1 UTSW 9 107579170 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCTCAGGTGAAGGTTAGAG -3'
(R):5'- ACTGGTCACGTTCACGATGAAG -3'

Sequencing Primer
(F):5'- GAGATTATTTGTCCCATCCAGTGATG -3'
(R):5'- TTCACGATGAAGGGCCCAAG -3'
Posted On2015-04-17