Incidental Mutation 'R3903:Grap'
ID309272
Institutional Source Beutler Lab
Gene Symbol Grap
Ensembl Gene ENSMUSG00000004837
Gene NameGRB2-related adaptor protein
Synonyms
MMRRC Submission 040907-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3903 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61653265-61672784 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to G at 61660325 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004959]
Predicted Effect probably null
Transcript: ENSMUST00000004959
SMART Domains Protein: ENSMUSP00000004959
Gene: ENSMUSG00000004837

DomainStartEndE-ValueType
SH3 1 57 5.43e-18 SMART
SH2 58 141 1.9e-33 SMART
SH3 161 216 3.32e-22 SMART
Meta Mutation Damage Score 0.6508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family and functions as a cytoplasmic signaling protein which contains an SH2 domain flanked by two SH3 domains. The SH2 domain interacts with ligand-activated receptors for stem cell factor and erythropoietin, and facilitates the formation of a stable complex with the BCR-ABL oncoprotein. This protein also associates with the Ras guanine nucleotide exchange factor SOS1 (son of sevenless homolog 1) through its N-terminal SH3 domain. In general, it couples signals from receptor and cytoplasmic tyrosine kinases to the Ras signaling pathway. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display a greater proliferative T cell response to TCR stimulation. In all other respects, they are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Ap3m1 T C 14: 21,036,664 Y185C probably null Het
Calcrl T A 2: 84,368,642 probably benign Het
Ccdc178 C T 18: 22,023,095 V573I possibly damaging Het
Cdh6 T C 15: 13,042,575 K499R probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Cyp4f40 C A 17: 32,659,624 R47S possibly damaging Het
Eif4a2 AG A 16: 23,110,640 probably null Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Gm8180 T A 14: 43,783,635 R39W probably null Het
Golm1 T C 13: 59,638,340 Q346R probably damaging Het
Hormad2 A G 11: 4,427,237 probably benign Het
Hyal1 T C 9: 107,578,972 probably null Het
Kif12 A G 4: 63,167,976 V378A possibly damaging Het
Lrrk2 A T 15: 91,747,700 S1276C probably damaging Het
Lrrk2 G A 15: 91,747,701 S1276N probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1276 A T 2: 111,257,769 Y218F probably damaging Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr898 C T 9: 38,349,658 Q186* probably null Het
Pabpc6 T C 17: 9,669,154 E156G probably benign Het
Rorb A G 19: 18,962,099 Y155H probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Scn1a A G 2: 66,318,132 I3T probably benign Het
Serpinb9 T C 13: 33,010,810 M183T possibly damaging Het
Wnk1 A G 6: 119,949,051 S1151P probably damaging Het
Xirp2 C T 2: 67,508,036 T207I probably benign Het
Zfp39 T C 11: 58,890,175 Y587C probably benign Het
Other mutations in Grap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0833:Grap UTSW 11 61660239 missense possibly damaging 0.73
R0836:Grap UTSW 11 61660239 missense possibly damaging 0.73
R1103:Grap UTSW 11 61671718 missense probably benign 0.01
R1479:Grap UTSW 11 61660298 missense probably benign 0.26
R1869:Grap UTSW 11 61664189 missense possibly damaging 0.94
R3843:Grap UTSW 11 61660325 splice site probably null
R4939:Grap UTSW 11 61660298 missense probably damaging 1.00
R6670:Grap UTSW 11 61660238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTGTGAGATGCCATAG -3'
(R):5'- ACGTCCCAGACCTAAGATATCTGG -3'

Sequencing Primer
(F):5'- TGAGATGCCATAGGTCCCCATC -3'
(R):5'- GATATCTGGGCCAAACTAGACTTC -3'
Posted On2015-04-17