Incidental Mutation 'R3909:Psmd2'
ID 309317
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Synonyms TEG-190, Tex190, 9430095H01Rik
MMRRC Submission 040814-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R3909 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20470402-20482164 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20474392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 316 (D316G)
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207] [ENSMUST00000232629]
AlphaFold Q8VDM4
Predicted Effect probably benign
Transcript: ENSMUST00000007212
AA Change: D316G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: D316G

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169195
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232629
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Meta Mutation Damage Score 0.1376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,625,125 (GRCm39) F501Y probably damaging Het
Alk T C 17: 72,204,906 (GRCm39) T1089A probably benign Het
Ankrd12 G T 17: 66,291,000 (GRCm39) P1478T probably benign Het
Arhgap39 A G 15: 76,636,088 (GRCm39) V49A probably benign Het
Arid4b T C 13: 14,307,069 (GRCm39) L108P probably damaging Het
Atrn T A 2: 130,836,127 (GRCm39) C1136S probably damaging Het
Cacna1s T A 1: 136,012,007 (GRCm39) M483K probably damaging Het
Cacng1 C A 11: 107,607,118 (GRCm39) V34L probably benign Het
Casp8 T C 1: 58,883,970 (GRCm39) S446P probably damaging Het
Cngb3 G A 4: 19,461,679 (GRCm39) C520Y probably damaging Het
Crim1 C T 17: 78,588,668 (GRCm39) probably benign Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fbxl17 G A 17: 63,806,802 (GRCm39) P71S possibly damaging Het
Fn1 C T 1: 71,647,072 (GRCm39) G1482R probably damaging Het
Gbp3 C T 3: 142,272,099 (GRCm39) probably benign Het
Golga4 A G 9: 118,387,804 (GRCm39) D1642G possibly damaging Het
Hspa1a C T 17: 35,190,703 (GRCm39) V67M probably damaging Het
Hyls1 T C 9: 35,472,705 (GRCm39) D237G probably damaging Het
Kmt2e A G 5: 23,706,624 (GRCm39) N1396D probably benign Het
Lasp1 G A 11: 97,690,653 (GRCm39) V12M probably damaging Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Muc5b C T 7: 141,403,235 (GRCm39) T732M unknown Het
Mxd1 G T 6: 86,627,942 (GRCm39) Q199K probably benign Het
Or14a258 T A 7: 86,035,182 (GRCm39) T229S probably benign Het
Or4a78 T C 2: 89,497,357 (GRCm39) E291G probably damaging Het
Or5w18 T A 2: 87,633,031 (GRCm39) F95L probably benign Het
Or5w20 T A 2: 87,727,293 (GRCm39) probably null Het
Prps1l1 A T 12: 35,035,797 (GRCm39) H304L possibly damaging Het
Rlf G A 4: 121,006,229 (GRCm39) T917I probably benign Het
Ryr3 T C 2: 112,466,953 (GRCm39) D4704G probably damaging Het
Scn1a T A 2: 66,104,332 (GRCm39) I1643F probably damaging Het
Vmn2r38 T C 7: 9,078,553 (GRCm39) K610E probably damaging Het
Zfc3h1 T C 10: 115,255,806 (GRCm39) F1486L probably benign Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20,478,155 (GRCm39) splice site probably null
IGL02348:Psmd2 APN 16 20,473,397 (GRCm39) missense probably benign 0.07
IGL02352:Psmd2 APN 16 20,475,691 (GRCm39) missense probably benign 0.13
IGL02359:Psmd2 APN 16 20,475,691 (GRCm39) missense probably benign 0.13
R0012:Psmd2 UTSW 16 20,480,434 (GRCm39) missense probably damaging 0.99
R0144:Psmd2 UTSW 16 20,480,975 (GRCm39) splice site probably null
R0565:Psmd2 UTSW 16 20,479,176 (GRCm39) missense probably null 0.63
R0739:Psmd2 UTSW 16 20,474,079 (GRCm39) missense probably benign 0.01
R1075:Psmd2 UTSW 16 20,478,709 (GRCm39) missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20,480,644 (GRCm39) missense probably benign 0.17
R1231:Psmd2 UTSW 16 20,474,335 (GRCm39) missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20,471,034 (GRCm39) missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20,471,034 (GRCm39) missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20,476,715 (GRCm39) unclassified probably benign
R1556:Psmd2 UTSW 16 20,474,335 (GRCm39) missense possibly damaging 0.83
R1843:Psmd2 UTSW 16 20,475,332 (GRCm39) missense probably benign 0.02
R2398:Psmd2 UTSW 16 20,478,222 (GRCm39) missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20,478,856 (GRCm39) splice site probably null
R2520:Psmd2 UTSW 16 20,481,826 (GRCm39) missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20,476,317 (GRCm39) missense probably benign 0.08
R3905:Psmd2 UTSW 16 20,474,392 (GRCm39) missense probably benign 0.07
R3906:Psmd2 UTSW 16 20,474,392 (GRCm39) missense probably benign 0.07
R4027:Psmd2 UTSW 16 20,481,955 (GRCm39) missense probably damaging 0.98
R4029:Psmd2 UTSW 16 20,481,955 (GRCm39) missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20,481,955 (GRCm39) missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20,475,402 (GRCm39) missense probably benign
R4410:Psmd2 UTSW 16 20,473,776 (GRCm39) missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20,478,719 (GRCm39) missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20,478,565 (GRCm39) unclassified probably benign
R4771:Psmd2 UTSW 16 20,481,429 (GRCm39) missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20,480,405 (GRCm39) missense probably benign 0.14
R5124:Psmd2 UTSW 16 20,471,448 (GRCm39) missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20,473,672 (GRCm39) missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20,474,023 (GRCm39) missense probably benign 0.03
R6732:Psmd2 UTSW 16 20,481,386 (GRCm39) missense probably benign 0.02
R6870:Psmd2 UTSW 16 20,480,593 (GRCm39) missense probably benign 0.33
R7030:Psmd2 UTSW 16 20,480,883 (GRCm39) missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20,471,377 (GRCm39) missense probably benign 0.12
R7432:Psmd2 UTSW 16 20,473,675 (GRCm39) missense probably damaging 0.99
R8673:Psmd2 UTSW 16 20,475,638 (GRCm39) missense probably damaging 1.00
R8685:Psmd2 UTSW 16 20,474,161 (GRCm39) missense probably benign
R9110:Psmd2 UTSW 16 20,470,994 (GRCm39) missense probably damaging 0.99
R9192:Psmd2 UTSW 16 20,473,412 (GRCm39) missense probably damaging 1.00
R9341:Psmd2 UTSW 16 20,475,441 (GRCm39) critical splice donor site probably null
R9343:Psmd2 UTSW 16 20,475,441 (GRCm39) critical splice donor site probably null
R9504:Psmd2 UTSW 16 20,478,160 (GRCm39) missense probably benign
R9526:Psmd2 UTSW 16 20,474,369 (GRCm39) missense probably benign 0.04
R9689:Psmd2 UTSW 16 20,479,173 (GRCm39) missense probably benign 0.05
Z1176:Psmd2 UTSW 16 20,481,410 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGACGTAGCAGTTTCTGATGC -3'
(R):5'- AAGCCAGAGGGTCACAACTG -3'

Sequencing Primer
(F):5'- AGCAGTTTCTGATGCGACAC -3'
(R):5'- AGAGGGTCACAACTGCTTCC -3'
Posted On 2015-04-17