Incidental Mutation 'R4025:Slc4a3'
ID313429
Institutional Source Beutler Lab
Gene Symbol Slc4a3
Ensembl Gene ENSMUSG00000006576
Gene Namesolute carrier family 4 (anion exchanger), member 3
SynonymsA930038D23Rik, Ae3
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4025 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75546266-75562172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75549041 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 262 (S262P)
Ref Sequence ENSEMBL: ENSMUSP00000116747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027415] [ENSMUST00000124341] [ENSMUST00000138814] [ENSMUST00000150142] [ENSMUST00000154101]
Predicted Effect probably damaging
Transcript: ENSMUST00000027415
AA Change: S262P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027415
Gene: ENSMUSG00000006576
AA Change: S262P

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 500 7.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124341
AA Change: S262P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116747
Gene: ENSMUSG00000006576
AA Change: S262P

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 618 2.9e-106 PFAM
low complexity region 629 639 N/A INTRINSIC
Pfam:HCO3_cotransp 674 1156 3.6e-203 PFAM
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129703
Predicted Effect probably benign
Transcript: ENSMUST00000132110
SMART Domains Protein: ENSMUSP00000119942
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
SCOP:d1hynp_ 4 72 9e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132612
Predicted Effect probably benign
Transcript: ENSMUST00000138814
SMART Domains Protein: ENSMUSP00000122749
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142257
Predicted Effect probably benign
Transcript: ENSMUST00000145258
SMART Domains Protein: ENSMUSP00000119860
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:Band_3_cyto 50 193 4.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145516
Predicted Effect probably benign
Transcript: ENSMUST00000150142
SMART Domains Protein: ENSMUSP00000120078
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154101
SMART Domains Protein: ENSMUSP00000116488
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:Band_3_cyto 152 227 2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189794
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane anion exchange protein. The encoded protein has been found in brain, heart, kidney, small intestine, and lung. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for one knock-out allele show inner retina defects including selective ERG b-wave depression, optic nerve and retinal vessel anomalies, sheathing of retinal vessels and late onset photoreceptor death. Homozygotes for another knock-out allele are more sensitive to seizure-inducing agents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl7 A G 15: 26,552,819 S121P probably benign Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nutm2 A G 13: 50,469,353 I29V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Olfr985 T C 9: 40,127,500 T154A probably benign Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ppm1d T A 11: 85,345,757 I454N probably benign Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc22a20 T C 19: 5,985,780 T121A probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Slc4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Slc4a3 APN 1 75555083 missense probably damaging 1.00
IGL00979:Slc4a3 APN 1 75554247 missense probably damaging 1.00
IGL01488:Slc4a3 APN 1 75548876 missense probably benign 0.45
IGL01567:Slc4a3 APN 1 75550882 missense probably damaging 1.00
IGL03090:Slc4a3 APN 1 75555017 missense probably benign 0.00
IGL03135:Slc4a3 APN 1 75547935 unclassified probably benign
R0004:Slc4a3 UTSW 1 75557009 unclassified probably benign
R0479:Slc4a3 UTSW 1 75551828 unclassified probably benign
R0507:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R0591:Slc4a3 UTSW 1 75549021 missense probably damaging 1.00
R0742:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R1577:Slc4a3 UTSW 1 75550891 missense probably damaging 1.00
R1794:Slc4a3 UTSW 1 75557308 missense probably damaging 0.99
R1804:Slc4a3 UTSW 1 75551717 missense probably damaging 1.00
R1911:Slc4a3 UTSW 1 75553723 missense probably damaging 1.00
R1974:Slc4a3 UTSW 1 75552191 nonsense probably null
R2696:Slc4a3 UTSW 1 75555475 missense possibly damaging 0.46
R2995:Slc4a3 UTSW 1 75552662 nonsense probably null
R3962:Slc4a3 UTSW 1 75556754 missense probably damaging 0.99
R4824:Slc4a3 UTSW 1 75550623 missense possibly damaging 0.54
R4858:Slc4a3 UTSW 1 75555085 missense probably damaging 1.00
R5075:Slc4a3 UTSW 1 75557368 missense probably damaging 1.00
R5450:Slc4a3 UTSW 1 75552656 missense probably damaging 1.00
R5636:Slc4a3 UTSW 1 75554216 missense possibly damaging 0.82
R5728:Slc4a3 UTSW 1 75549840 missense probably benign 0.05
R5921:Slc4a3 UTSW 1 75557444 critical splice donor site probably null
R5969:Slc4a3 UTSW 1 75549979 missense probably damaging 0.98
R6272:Slc4a3 UTSW 1 75554697 critical splice donor site probably null
R6749:Slc4a3 UTSW 1 75554538 nonsense probably null
R6788:Slc4a3 UTSW 1 75551315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTCAGCAGCTCCTTGC -3'
(R):5'- TAGGTGACTCAGAGAGCACTC -3'

Sequencing Primer
(F):5'- TAAAGCCTCATAACTTCCTCAGCTC -3'
(R):5'- ACTCCCGAGTGACACTAAGG -3'
Posted On2015-04-30