Incidental Mutation 'R0742:Slc4a3'
ID70713
Institutional Source Beutler Lab
Gene Symbol Slc4a3
Ensembl Gene ENSMUSG00000006576
Gene Namesolute carrier family 4 (anion exchanger), member 3
SynonymsA930038D23Rik, Ae3
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75546266-75562172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75556081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 995 (I995K)
Ref Sequence ENSEMBL: ENSMUSP00000116747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027415] [ENSMUST00000124341] [ENSMUST00000154101]
Predicted Effect probably benign
Transcript: ENSMUST00000027415
SMART Domains Protein: ENSMUSP00000027415
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 500 7.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124341
AA Change: I995K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116747
Gene: ENSMUSG00000006576
AA Change: I995K

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 618 2.9e-106 PFAM
low complexity region 629 639 N/A INTRINSIC
Pfam:HCO3_cotransp 674 1156 3.6e-203 PFAM
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132110
SMART Domains Protein: ENSMUSP00000119942
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
SCOP:d1hynp_ 4 72 9e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142257
Predicted Effect probably benign
Transcript: ENSMUST00000145258
SMART Domains Protein: ENSMUSP00000119860
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:Band_3_cyto 50 193 4.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154101
SMART Domains Protein: ENSMUSP00000116488
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Pfam:Band_3_cyto 152 227 2e-32 PFAM
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane anion exchange protein. The encoded protein has been found in brain, heart, kidney, small intestine, and lung. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for one knock-out allele show inner retina defects including selective ERG b-wave depression, optic nerve and retinal vessel anomalies, sheathing of retinal vessels and late onset photoreceptor death. Homozygotes for another knock-out allele are more sensitive to seizure-inducing agents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Slc4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Slc4a3 APN 1 75555083 missense probably damaging 1.00
IGL00979:Slc4a3 APN 1 75554247 missense probably damaging 1.00
IGL01488:Slc4a3 APN 1 75548876 missense probably benign 0.45
IGL01567:Slc4a3 APN 1 75550882 missense probably damaging 1.00
IGL03090:Slc4a3 APN 1 75555017 missense probably benign 0.00
IGL03135:Slc4a3 APN 1 75547935 unclassified probably benign
R0004:Slc4a3 UTSW 1 75557009 unclassified probably benign
R0479:Slc4a3 UTSW 1 75551828 unclassified probably benign
R0507:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R0591:Slc4a3 UTSW 1 75549021 missense probably damaging 1.00
R1577:Slc4a3 UTSW 1 75550891 missense probably damaging 1.00
R1794:Slc4a3 UTSW 1 75557308 missense probably damaging 0.99
R1804:Slc4a3 UTSW 1 75551717 missense probably damaging 1.00
R1911:Slc4a3 UTSW 1 75553723 missense probably damaging 1.00
R1974:Slc4a3 UTSW 1 75552191 nonsense probably null
R2696:Slc4a3 UTSW 1 75555475 missense possibly damaging 0.46
R2995:Slc4a3 UTSW 1 75552662 nonsense probably null
R3962:Slc4a3 UTSW 1 75556754 missense probably damaging 0.99
R4025:Slc4a3 UTSW 1 75549041 missense probably damaging 1.00
R4824:Slc4a3 UTSW 1 75550623 missense possibly damaging 0.54
R4858:Slc4a3 UTSW 1 75555085 missense probably damaging 1.00
R5075:Slc4a3 UTSW 1 75557368 missense probably damaging 1.00
R5450:Slc4a3 UTSW 1 75552656 missense probably damaging 1.00
R5636:Slc4a3 UTSW 1 75554216 missense possibly damaging 0.82
R5728:Slc4a3 UTSW 1 75549840 missense probably benign 0.05
R5921:Slc4a3 UTSW 1 75557444 critical splice donor site probably null
R5969:Slc4a3 UTSW 1 75549979 missense probably damaging 0.98
R6272:Slc4a3 UTSW 1 75554697 critical splice donor site probably null
R6749:Slc4a3 UTSW 1 75554538 nonsense probably null
R6788:Slc4a3 UTSW 1 75551315 missense probably damaging 1.00
R7308:Slc4a3 UTSW 1 75557362 missense probably benign 0.00
R7487:Slc4a3 UTSW 1 75553377 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCCTGCCATGCAGAAGCTGAC -3'
(R):5'- TCTGAGAACTTCCAAGTGCCACCC -3'

Sequencing Primer
(F):5'- AGAAGCTGACGGTGCCTAC -3'
(R):5'- tcctcctcctcctcctcc -3'
Posted On2013-09-30