Incidental Mutation 'R4178:Zfpm2'
ID 319607
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms FOG2, B330005D23Rik, FOG-2
MMRRC Submission 040864-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4178 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 40518438-40967988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40966940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1010 (C1010R)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably damaging
Transcript: ENSMUST00000053467
AA Change: C1142R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: C1142R

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230319
AA Change: C1010R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 33,776,928 (GRCm39) probably null Het
Atp2b2 A T 6: 113,770,679 (GRCm39) V410E probably damaging Het
C6 G A 15: 4,764,621 (GRCm39) V106I probably benign Het
Cdhr1 A C 14: 36,804,896 (GRCm39) probably null Het
Cfap44 T A 16: 44,272,216 (GRCm39) L1323Q possibly damaging Het
Ehd4 T A 2: 119,984,829 (GRCm39) Y43F probably damaging Het
Eno1 T C 4: 150,328,490 (GRCm39) I90T possibly damaging Het
Epb41l1 A G 2: 156,363,477 (GRCm39) Y662C probably benign Het
Fkbp14 A G 6: 54,566,299 (GRCm39) L103P probably damaging Het
Gm10322 C A 10: 59,452,052 (GRCm39) N56K probably benign Het
Iqcd C A 5: 120,740,476 (GRCm39) T269K probably damaging Het
Kat6b T A 14: 21,668,972 (GRCm39) C249* probably null Het
Kcnab2 T C 4: 152,489,058 (GRCm39) R109G probably null Het
Obox7 A G 7: 14,398,032 (GRCm39) Q24R probably damaging Het
Obox7 C A 7: 14,398,031 (GRCm39) Q24K probably damaging Het
Or5p1 A G 7: 107,916,565 (GRCm39) N155D probably damaging Het
Or5p68 G A 7: 107,945,765 (GRCm39) T141I probably benign Het
Or8g18 A C 9: 39,149,375 (GRCm39) L115* probably null Het
Rasgrf2 C T 13: 92,038,717 (GRCm39) G1043D probably damaging Het
Slf1 A G 13: 77,191,688 (GRCm39) S1049P probably damaging Het
Smc1b A T 15: 85,004,848 (GRCm39) F409I possibly damaging Het
Tab2 A G 10: 7,795,123 (GRCm39) V453A probably damaging Het
Ubr4 A G 4: 139,120,725 (GRCm39) Y338C probably damaging Het
Usp6nl A G 2: 6,445,787 (GRCm39) E588G probably benign Het
Vcan T C 13: 89,873,666 (GRCm39) R63G probably damaging Het
Zfp775 A G 6: 48,590,187 (GRCm39) probably null Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 40,962,683 (GRCm39) missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 40,962,887 (GRCm39) missense probably benign 0.37
IGL00821:Zfpm2 APN 15 40,966,783 (GRCm39) missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01623:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40,616,452 (GRCm39) critical splice donor site probably null
IGL01872:Zfpm2 APN 15 40,965,783 (GRCm39) missense probably benign
IGL02087:Zfpm2 APN 15 40,966,517 (GRCm39) missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 40,965,591 (GRCm39) missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 40,962,868 (GRCm39) missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 40,965,415 (GRCm39) missense probably benign 0.23
IGL02792:Zfpm2 APN 15 40,966,409 (GRCm39) missense probably benign 0.00
IGL02861:Zfpm2 APN 15 40,966,662 (GRCm39) missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 40,964,790 (GRCm39) missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 40,966,170 (GRCm39) missense probably benign
R0305:Zfpm2 UTSW 15 40,637,431 (GRCm39) splice site probably benign
R0365:Zfpm2 UTSW 15 40,637,462 (GRCm39) missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 40,965,075 (GRCm39) missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 40,965,877 (GRCm39) missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 40,962,687 (GRCm39) missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 40,966,605 (GRCm39) missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 40,966,419 (GRCm39) missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 40,964,579 (GRCm39) missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2886:Zfpm2 UTSW 15 40,965,719 (GRCm39) missense probably benign 0.44
R3024:Zfpm2 UTSW 15 40,966,355 (GRCm39) missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40,734,023 (GRCm39) missense possibly damaging 0.94
R4465:Zfpm2 UTSW 15 40,959,557 (GRCm39) missense probably benign 0.00
R5263:Zfpm2 UTSW 15 40,962,791 (GRCm39) missense probably benign 0.45
R5266:Zfpm2 UTSW 15 40,962,865 (GRCm39) missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40,733,938 (GRCm39) missense probably benign 0.01
R5584:Zfpm2 UTSW 15 40,965,933 (GRCm39) missense probably benign 0.45
R5661:Zfpm2 UTSW 15 40,959,467 (GRCm39) nonsense probably null
R6437:Zfpm2 UTSW 15 40,962,793 (GRCm39) missense probably benign
R6660:Zfpm2 UTSW 15 40,518,981 (GRCm39) critical splice donor site probably null
R6742:Zfpm2 UTSW 15 40,965,114 (GRCm39) missense probably benign
R6749:Zfpm2 UTSW 15 40,818,104 (GRCm39) missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40,616,413 (GRCm39) missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 40,966,386 (GRCm39) missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 40,966,671 (GRCm39) missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40,818,162 (GRCm39) missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 40,959,487 (GRCm39) missense probably benign 0.03
R7893:Zfpm2 UTSW 15 40,966,008 (GRCm39) missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 40,965,644 (GRCm39) missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40,616,355 (GRCm39) missense probably benign 0.34
R9028:Zfpm2 UTSW 15 40,966,758 (GRCm39) missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 40,962,712 (GRCm39) missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 40,966,470 (GRCm39) missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 40,966,867 (GRCm39) missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 40,965,710 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCAAATGAGAATGTCTCCCCAG -3'
(R):5'- ACCACAGCTATGAATACTGCTG -3'

Sequencing Primer
(F):5'- TGAGAATGTCTCCCCAGGAATTC -3'
(R):5'- TACACCTTAAGTCTTCAATTCAGCC -3'
Posted On 2015-06-10