Incidental Mutation 'R4226:Ap4m1'
ID320035
Institutional Source Beutler Lab
Gene Symbol Ap4m1
Ensembl Gene ENSMUSG00000019518
Gene Nameadaptor-related protein complex AP-4, mu 1
Synonyms
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4226 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138172002-138180429 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 138172817 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 74 (R74*)
Ref Sequence ENSEMBL: ENSMUSP00000121338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019662] [ENSMUST00000139983] [ENSMUST00000143241] [ENSMUST00000147920] [ENSMUST00000148094] [ENSMUST00000148879] [ENSMUST00000151318] [ENSMUST00000153867] [ENSMUST00000155902]
Predicted Effect probably benign
Transcript: ENSMUST00000000505
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000019662
AA Change: R60*
SMART Domains Protein: ENSMUSP00000019662
Gene: ENSMUSG00000019518
AA Change: R60*

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 142 2e-49 SMART
Pfam:Adap_comp_sub 173 449 2.5e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139223
Predicted Effect probably benign
Transcript: ENSMUST00000139983
SMART Domains Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142687
Predicted Effect probably null
Transcript: ENSMUST00000143241
AA Change: R60*
SMART Domains Protein: ENSMUSP00000123770
Gene: ENSMUSG00000019518
AA Change: R60*

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 86 2e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147920
Predicted Effect probably benign
Transcript: ENSMUST00000148094
SMART Domains Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 1 25 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151318
AA Change: R74*
SMART Domains Protein: ENSMUSP00000121338
Gene: ENSMUSG00000019518
AA Change: R74*

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 47 153 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155745
Predicted Effect probably benign
Transcript: ENSMUST00000155902
SMART Domains Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157031
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric AP-4 complex. The encoded protein belongs to the adaptor complexes medium subunits family. This AP-4 complex is involved in the recognition and sorting of cargo proteins with tyrosine-based motifs from the trans-golgi network to the endosomal-lysosomal system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Dnm1l A T 16: 16,314,387 H653Q possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Micu2 T C 14: 57,932,285 K203E possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem236 G T 2: 14,174,626 E13* probably null Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn1r39 T C 6: 66,804,719 H205R possibly damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Ap4m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Ap4m1 APN 5 138172844 missense probably damaging 0.98
IGL03087:Ap4m1 APN 5 138174804 missense probably benign 0.01
R0227:Ap4m1 UTSW 5 138176276 unclassified probably benign
R0394:Ap4m1 UTSW 5 138172203 missense probably benign 0.32
R0639:Ap4m1 UTSW 5 138176239 missense probably benign 0.01
R4357:Ap4m1 UTSW 5 138173049 missense probably damaging 1.00
R5544:Ap4m1 UTSW 5 138178370 missense probably benign 0.15
R5585:Ap4m1 UTSW 5 138172240 missense probably damaging 1.00
R5631:Ap4m1 UTSW 5 138174789 makesense probably null
R5691:Ap4m1 UTSW 5 138172391 missense probably damaging 1.00
R6504:Ap4m1 UTSW 5 138178096 missense probably benign
R6636:Ap4m1 UTSW 5 138172175 unclassified probably benign
R6637:Ap4m1 UTSW 5 138172175 unclassified probably benign
X0062:Ap4m1 UTSW 5 138178311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TACCTTTCCACGTTAGGCGG -3'
(R):5'- GTAGACAAGCGCCACATTGC -3'

Sequencing Primer
(F):5'- TAGGCGGCCAGGTCTTAGATC -3'
(R):5'- TCATTGAGTGAGCCACAGTAGTCAC -3'
Posted On2015-06-12