Incidental Mutation 'R4232:Mrps30'
ID320924
Institutional Source Beutler Lab
Gene Symbol Mrps30
Ensembl Gene ENSMUSG00000021731
Gene Namemitochondrial ribosomal protein S30
Synonyms2610020A16Rik, Pdcd9
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4232 (G1)
Quality Score166
Status Validated
Chromosome13
Chromosomal Location118378381-118387252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118386840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000022245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]
Predicted Effect probably damaging
Transcript: ENSMUST00000022245
AA Change: D132G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: D132G

DomainStartEndE-ValueType
Pfam:PDCD9 1 423 1.7e-180 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181168
AA Change: S13P
SMART Domains Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225170
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Mrps30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Mrps30 APN 13 118380610 missense probably damaging 1.00
R0030:Mrps30 UTSW 13 118382995 missense possibly damaging 0.94
R2439:Mrps30 UTSW 13 118385272 missense probably damaging 1.00
R2764:Mrps30 UTSW 13 118384588 missense probably benign 0.03
R4030:Mrps30 UTSW 13 118380541 missense probably damaging 1.00
R4231:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4234:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4235:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4236:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4625:Mrps30 UTSW 13 118386714 missense probably benign 0.14
R4935:Mrps30 UTSW 13 118386895 missense possibly damaging 0.82
R5363:Mrps30 UTSW 13 118387162 missense probably benign 0.39
R5986:Mrps30 UTSW 13 118384565 critical splice donor site probably null
R6566:Mrps30 UTSW 13 118387126 missense probably benign 0.00
R6681:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6694:Mrps30 UTSW 13 118386961 missense possibly damaging 0.82
R6699:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6700:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6788:Mrps30 UTSW 13 118380372 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACTGAACCTGCAGGAAAGCTTG -3'
(R):5'- ATTGTCCCAGAATGCCGCTG -3'

Sequencing Primer
(F):5'- TGGGAGTTCCAAGCTCACC -3'
(R):5'- TCCCAGAATGCCGCTGCTAAG -3'
Posted On2015-06-12