Incidental Mutation 'R4303:Krt36'
ID322507
Institutional Source Beutler Lab
Gene Symbol Krt36
Ensembl Gene ENSMUSG00000020916
Gene Namekeratin 36
SynonymsKrt1-22, keratin 5, HRa-1, Krt1-5
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100102007-100105626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100103413 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 279 (D279E)
Ref Sequence ENSEMBL: ENSMUSP00000103039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107416
AA Change: D279E

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103039
Gene: ENSMUSG00000020916
AA Change: D279E

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Filament 92 403 4.05e-163 SMART
low complexity region 425 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127883
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperkeratosis affecting the scales of the tail skin and the filiform papillae of the tongue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Krt36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Krt36 APN 11 100102948 missense probably damaging 0.98
IGL01737:Krt36 APN 11 100104120 missense possibly damaging 0.62
IGL02388:Krt36 APN 11 100105164 nonsense probably null
IGL02985:Krt36 APN 11 100103179 missense probably benign 0.32
R0393:Krt36 UTSW 11 100104114 missense possibly damaging 0.91
R0617:Krt36 UTSW 11 100102275 missense probably damaging 1.00
R0930:Krt36 UTSW 11 100103399 missense probably damaging 1.00
R1166:Krt36 UTSW 11 100102828 missense probably benign 0.00
R1201:Krt36 UTSW 11 100104057 missense probably benign 0.22
R1587:Krt36 UTSW 11 100102302 missense probably damaging 1.00
R1750:Krt36 UTSW 11 100104058 missense probably benign 0.00
R1826:Krt36 UTSW 11 100103030 splice site probably benign
R1846:Krt36 UTSW 11 100105548 missense probably damaging 1.00
R2208:Krt36 UTSW 11 100102939 missense probably damaging 0.96
R5140:Krt36 UTSW 11 100103502 missense probably damaging 1.00
R5719:Krt36 UTSW 11 100104161 missense possibly damaging 0.95
R5944:Krt36 UTSW 11 100105313 missense probably benign
R6188:Krt36 UTSW 11 100102420 missense probably benign 0.00
R6271:Krt36 UTSW 11 100104472 nonsense probably null
R6809:Krt36 UTSW 11 100105509 missense probably benign 0.00
R6856:Krt36 UTSW 11 100103390 missense probably damaging 1.00
Z1088:Krt36 UTSW 11 100104189 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCTCAATGATCTCTGTCTGGC -3'
(R):5'- ATCCAGGTCATTGAACCTACC -3'

Sequencing Primer
(F):5'- AATGATCTCTGTCTGGCAACACTG -3'
(R):5'- GGTCATTGAACCTACCAAGCC -3'
Posted On2015-06-20