Incidental Mutation 'R4260:Eif2ak3'
ID322605
Institutional Source Beutler Lab
Gene Symbol Eif2ak3
Ensembl Gene ENSMUSG00000031668
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 3
SynonymsPERK
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location70844515-70905245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70889513 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 597 (R597H)
Ref Sequence ENSEMBL: ENSMUSP00000034093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034093]
Predicted Effect probably damaging
Transcript: ENSMUST00000034093
AA Change: R597H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034093
Gene: ENSMUSG00000031668
AA Change: R597H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 48 82 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 221 230 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Pfam:Pkinase_Tyr 589 662 1.6e-6 PFAM
Pfam:Pkinase 589 673 3.2e-12 PFAM
Pfam:Pkinase 839 1075 1.9e-38 PFAM
Pfam:Pkinase_Tyr 859 1073 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199580
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in a similar gene in human are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice develop exocrine pancreatic insufficiency and progressive diabetes mellitus. They are growth retarded, hyperglycemic, exhibit increased cell death in the pancreas, have decreased numbers of pancreatic beta cells and about half diebefore weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Eif2ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Eif2ak3 APN 6 70892726 missense probably damaging 1.00
IGL02069:Eif2ak3 APN 6 70896965 missense probably damaging 1.00
IGL02197:Eif2ak3 APN 6 70901457 missense probably benign 0.37
IGL03150:Eif2ak3 APN 6 70892436 missense possibly damaging 0.68
R0024:Eif2ak3 UTSW 6 70892356 missense probably benign 0.01
R0130:Eif2ak3 UTSW 6 70881732 splice site probably benign
R0394:Eif2ak3 UTSW 6 70885218 missense probably benign 0.03
R0699:Eif2ak3 UTSW 6 70892530 missense probably benign 0.16
R1648:Eif2ak3 UTSW 6 70883631 missense possibly damaging 0.52
R1708:Eif2ak3 UTSW 6 70887806 missense probably damaging 0.99
R1953:Eif2ak3 UTSW 6 70892554 missense probably benign 0.03
R2062:Eif2ak3 UTSW 6 70904197 missense probably benign 0.02
R2875:Eif2ak3 UTSW 6 70883639 missense probably damaging 1.00
R4357:Eif2ak3 UTSW 6 70884875 missense probably damaging 0.98
R4786:Eif2ak3 UTSW 6 70892618 missense possibly damaging 0.95
R4801:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R4802:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R5194:Eif2ak3 UTSW 6 70858478 missense possibly damaging 0.83
R5260:Eif2ak3 UTSW 6 70893129 missense probably damaging 1.00
R5710:Eif2ak3 UTSW 6 70883733 missense probably damaging 1.00
R5724:Eif2ak3 UTSW 6 70876840 missense probably benign 0.19
R6089:Eif2ak3 UTSW 6 70896934 missense possibly damaging 0.87
R6656:Eif2ak3 UTSW 6 70883715 missense probably damaging 1.00
R6940:Eif2ak3 UTSW 6 70892402 missense possibly damaging 0.82
R6949:Eif2ak3 UTSW 6 70878845 missense probably damaging 0.99
R6958:Eif2ak3 UTSW 6 70892683 missense probably benign 0.01
R7168:Eif2ak3 UTSW 6 70881626 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACTGCTAGTCAAGTTCTCGC -3'
(R):5'- GTCGCTTCGAACCAAAGAGTTG -3'

Sequencing Primer
(F):5'- CGCTGTGCTATCTATGCGATACG -3'
(R):5'- TTGGAAGTAGAAAGCACACTGTGAC -3'
Posted On2015-06-20