Incidental Mutation 'R1648:Eif2ak3'
ID174016
Institutional Source Beutler Lab
Gene Symbol Eif2ak3
Ensembl Gene ENSMUSG00000031668
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 3
SynonymsPERK
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.801) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location70844515-70905245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70883631 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 397 (V397D)
Ref Sequence ENSEMBL: ENSMUSP00000034093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034093
AA Change: V397D

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034093
Gene: ENSMUSG00000031668
AA Change: V397D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 48 82 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 221 230 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Pfam:Pkinase_Tyr 589 662 1.6e-6 PFAM
Pfam:Pkinase 589 673 3.2e-12 PFAM
Pfam:Pkinase 839 1075 1.9e-38 PFAM
Pfam:Pkinase_Tyr 859 1073 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199580
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in a similar gene in human are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice develop exocrine pancreatic insufficiency and progressive diabetes mellitus. They are growth retarded, hyperglycemic, exhibit increased cell death in the pancreas, have decreased numbers of pancreatic beta cells and about half diebefore weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Eif2ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Eif2ak3 APN 6 70892726 missense probably damaging 1.00
IGL02069:Eif2ak3 APN 6 70896965 missense probably damaging 1.00
IGL02197:Eif2ak3 APN 6 70901457 missense probably benign 0.37
IGL03150:Eif2ak3 APN 6 70892436 missense possibly damaging 0.68
R0024:Eif2ak3 UTSW 6 70892356 missense probably benign 0.01
R0130:Eif2ak3 UTSW 6 70881732 splice site probably benign
R0394:Eif2ak3 UTSW 6 70885218 missense probably benign 0.03
R0699:Eif2ak3 UTSW 6 70892530 missense probably benign 0.16
R1708:Eif2ak3 UTSW 6 70887806 missense probably damaging 0.99
R1953:Eif2ak3 UTSW 6 70892554 missense probably benign 0.03
R2062:Eif2ak3 UTSW 6 70904197 missense probably benign 0.02
R2875:Eif2ak3 UTSW 6 70883639 missense probably damaging 1.00
R4260:Eif2ak3 UTSW 6 70889513 missense probably damaging 0.98
R4357:Eif2ak3 UTSW 6 70884875 missense probably damaging 0.98
R4786:Eif2ak3 UTSW 6 70892618 missense possibly damaging 0.95
R4801:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R4802:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R5194:Eif2ak3 UTSW 6 70858478 missense possibly damaging 0.83
R5260:Eif2ak3 UTSW 6 70893129 missense probably damaging 1.00
R5710:Eif2ak3 UTSW 6 70883733 missense probably damaging 1.00
R5724:Eif2ak3 UTSW 6 70876840 missense probably benign 0.19
R6089:Eif2ak3 UTSW 6 70896934 missense possibly damaging 0.87
R6656:Eif2ak3 UTSW 6 70883715 missense probably damaging 1.00
R6940:Eif2ak3 UTSW 6 70892402 missense possibly damaging 0.82
R6949:Eif2ak3 UTSW 6 70878845 missense probably damaging 0.99
R6958:Eif2ak3 UTSW 6 70892683 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAAGGTGCTATTATTCAGTTCGGGGA -3'
(R):5'- ATGGCCTGGCTTATTCTGTTTTAAATGC -3'

Sequencing Primer
(F):5'- CTATTATTCAGTTCGGGGAACATTG -3'
(R):5'- acctcctgcttccacattc -3'
Posted On2014-04-24