Incidental Mutation 'R0052:Slc4a4'
ID33033
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission 038346-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0052 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89156336 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 502 (H502P)
Ref Sequence ENSEMBL: ENSMUSP00000118413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect probably benign
Transcript: ENSMUST00000113218
AA Change: H537P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: H537P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130041
AA Change: H502P

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: H502P

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148750
AA Change: H546P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: H546P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156238
AA Change: H546P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: H546P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,915,951 S438P possibly damaging Het
Atp2a1 A G 7: 126,457,897 probably benign Het
Axin2 T C 11: 108,949,270 Y735H probably damaging Het
Bicd2 T A 13: 49,375,314 L184Q probably damaging Het
Bub1 G A 2: 127,809,039 T618I probably benign Het
Catsperg2 A G 7: 29,725,020 probably benign Het
Ccdc73 T A 2: 104,929,570 probably benign Het
Crybg3 A T 16: 59,565,656 probably benign Het
Dsp A G 13: 38,197,364 D2096G possibly damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Elp3 A G 14: 65,531,526 *548Q probably null Het
Eno4 A G 19: 58,968,553 D357G probably damaging Het
Fam214a A G 9: 75,018,983 probably benign Het
Fcrls A T 3: 87,256,778 I348N possibly damaging Het
Fgl2 A T 5: 21,375,349 S230C probably damaging Het
Ginm1 T A 10: 7,779,306 E57D possibly damaging Het
Gtf3c1 A T 7: 125,667,971 probably null Het
Herc1 G T 9: 66,400,156 G1044V probably damaging Het
Hmcn1 G A 1: 150,677,406 T2511M probably damaging Het
Iba57 C T 11: 59,158,901 A207T probably benign Het
Itga9 T A 9: 118,636,549 I157N probably damaging Het
Kalrn A G 16: 34,357,171 L208P probably damaging Het
Kcnj10 A G 1: 172,368,924 T2A probably benign Het
Kdm1b T A 13: 47,064,117 C351S probably damaging Het
Kif21a T C 15: 90,970,857 E700G probably damaging Het
Mmd C T 11: 90,259,998 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Morn3 T C 5: 123,046,663 Y38C probably damaging Het
Nacc1 A T 8: 84,676,225 V313D probably benign Het
Nbeal1 T A 1: 60,228,612 probably benign Het
Neb T C 2: 52,273,980 K1989E possibly damaging Het
Nlrp3 C T 11: 59,565,128 R917* probably null Het
Nlrp4b T A 7: 10,725,962 Y463* probably null Het
Perm1 A T 4: 156,218,115 D372V probably damaging Het
Phf3 T C 1: 30,808,767 T1232A probably damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pld4 T A 12: 112,767,857 F386I probably benign Het
Prex2 T A 1: 11,160,156 L802Q probably damaging Het
Psd3 A G 8: 67,882,979 probably null Het
Ralgds T A 2: 28,544,388 probably null Het
Rmdn2 A G 17: 79,650,331 E16G probably damaging Het
Rnf111 A T 9: 70,476,389 S87R probably benign Het
Slc9c1 A G 16: 45,606,856 probably benign Het
Slco3a1 A T 7: 74,504,326 I166N probably benign Het
Snx5 A T 2: 144,259,192 probably null Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
St8sia2 G T 7: 73,943,290 Y339* probably null Het
St8sia2 A T 7: 73,971,952 W86R probably damaging Het
Stk33 A G 7: 109,279,669 L491P possibly damaging Het
Sult2a7 T C 7: 14,465,208 Y298C probably damaging Het
Tdo2 T A 3: 81,967,025 N210I probably benign Het
Thada A T 17: 84,455,158 N104K probably damaging Het
Timm8b A T 9: 50,605,030 D61V possibly damaging Het
Tshz1 G A 18: 84,014,945 T446I possibly damaging Het
Ubap2l T C 3: 90,038,928 N123S possibly damaging Het
Vmn1r48 T C 6: 90,036,264 E193G possibly damaging Het
Vmn1r69 C T 7: 10,580,400 V135I probably benign Het
Vmn2r103 G T 17: 19,811,641 G559V probably benign Het
Vmn2r26 T A 6: 124,062,033 *856R probably null Het
Vmn2r88 A G 14: 51,418,700 I798V possibly damaging Het
Vsir C T 10: 60,358,082 A108V probably benign Het
Zfp14 G T 7: 30,038,328 Q411K probably damaging Het
Zfp236 A T 18: 82,639,332 M762K probably damaging Het
Zfp462 G A 4: 55,011,762 G1243S probably benign Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0055:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6727:Slc4a4 UTSW 5 89170765 missense probably benign 0.00
R6844:Slc4a4 UTSW 5 89228972 missense probably damaging 1.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7180:Slc4a4 UTSW 5 89046236 missense probably damaging 0.97
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
Predicted Primers PCR Primer
(F):5'- gcttccacctcagAAGTTATTATTGAAAGCA -3'
(R):5'- CCAGAATTAAACTAAAAGGTCCCACTTATCCA -3'

Sequencing Primer
(F):5'- TTGAAAGCAATAATTAGTGACCCCC -3'
(R):5'- TGTACTGCAACTGTGCAAAC -3'
Posted On2013-05-09