Mutagenetix > Incidental Mutation

Incidental Mutation 'R4495:Kidins220'

330938

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

041583-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25024924-25113151 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 25088301 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

AlphaFold

E9Q9B7

Predicted Effect

probably null
Transcript: ENSMUST00000066652

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000066652

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000220459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220622

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221423

Predicted Effect

probably null
Transcript: ENSMUST00000222013

Predicted Effect

probably null
Transcript: ENSMUST00000222941

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Calcr	A	T	6: 3,708,484 (GRCm39)		probably null	Het
Cdh4	T	C	2: 179,422,182 (GRCm39)	V102A	probably damaging	Het
Cmya5	T	C	13: 93,230,573 (GRCm39)	E1505G	probably benign	Het
Cyp2b9	T	A	7: 25,900,180 (GRCm39)	D329E	probably benign	Het
Ddx47	T	C	6: 134,998,429 (GRCm39)	F375S	possibly damaging	Het
Dnah7b	T	G	1: 46,124,792 (GRCm39)	S154A	probably benign	Het
Fry	G	T	5: 150,233,928 (GRCm39)	E133D	probably damaging	Het
Hydin	T	C	8: 111,322,034 (GRCm39)	L4562P	probably damaging	Het
Ifnlr1	A	T	4: 135,433,079 (GRCm39)	E505V	probably damaging	Het
Igfn1	T	C	1: 135,897,416 (GRCm39)	E1050G	possibly damaging	Het
Klra10	T	G	6: 130,256,311 (GRCm39)	E114D	probably benign	Het
Lyst	G	A	13: 13,809,968 (GRCm39)	R546H	probably damaging	Het
Mrc2	G	A	11: 105,239,257 (GRCm39)		probably null	Het
Mrgpra3	T	C	7: 47,239,813 (GRCm39)	I38V	probably benign	Het
Nfkb2	A	G	19: 46,296,878 (GRCm39)	D316G	probably damaging	Het
Nrxn2	A	T	19: 6,581,429 (GRCm39)	T412S	probably benign	Het
Or4k37	T	A	2: 111,159,365 (GRCm39)	N200K	probably benign	Het
Palm3	C	T	8: 84,753,495 (GRCm39)	R97C	probably damaging	Het
Pdcd11	T	C	19: 47,099,445 (GRCm39)	V848A	probably benign	Het
Prdx1	T	C	4: 116,556,416 (GRCm39)	V188A	probably benign	Het
Prep	T	C	10: 44,996,915 (GRCm39)	F398L	probably benign	Het
Prlhr	A	T	19: 60,455,519 (GRCm39)	M349K	probably benign	Het
Rwdd2b	T	C	16: 87,231,450 (GRCm39)	T235A	probably benign	Het
Scn1a	T	C	2: 66,111,146 (GRCm39)		probably null	Het
Sidt1	C	T	16: 44,102,841 (GRCm39)	V295M	probably damaging	Het
Sla	T	C	15: 66,673,361 (GRCm39)	T10A	probably benign	Het
Slc22a20	A	G	19: 6,034,952 (GRCm39)	S170P	probably benign	Het
Syt6	C	A	3: 103,494,876 (GRCm39)	C280*	probably null	Het
Thbs2	A	G	17: 14,891,675 (GRCm39)	I954T	probably damaging	Het
Tmprss11b	T	A	5: 86,812,922 (GRCm39)	K125*	probably null	Het
Ugt1a6a	T	A	1: 88,066,905 (GRCm39)	L237H	probably damaging	Het
Vmn2r68	TCC	TC	7: 84,870,758 (GRCm39)		probably null	Het
Wdr53	A	G	16: 32,070,969 (GRCm39)	T105A	probably benign	Het
Xkrx	T	C	X: 133,051,745 (GRCm39)	N302S	possibly damaging	Het
Zfp704	T	A	3: 9,536,137 (GRCm39)	S128C	probably benign	Het
Zfp759	A	G	13: 67,286,989 (GRCm39)		probably null	Het
Zfyve16	A	T	13: 92,625,075 (GRCm39)	D1494E	probably benign	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25,088,559 (GRCm39)	splice site	probably benign
IGL00959:Kidins220	APN	12	25,101,132 (GRCm39)	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25,107,473 (GRCm39)	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25,060,925 (GRCm39)	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25,088,498 (GRCm39)	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25,090,459 (GRCm39)	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	25,044,999 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25,107,728 (GRCm39)	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	25,047,332 (GRCm39)	splice site	probably benign
IGL02673:Kidins220	APN	12	25,044,991 (GRCm39)	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25,053,092 (GRCm39)	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25,053,044 (GRCm39)	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25,058,447 (GRCm39)	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	25,049,344 (GRCm39)	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25,058,155 (GRCm39)	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25,090,511 (GRCm39)	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25,060,140 (GRCm39)	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25,058,068 (GRCm39)	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25,055,087 (GRCm39)	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25,063,445 (GRCm39)	splice site	probably benign
R1808:Kidins220	UTSW	12	25,053,008 (GRCm39)	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25,106,590 (GRCm39)	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	25,044,905 (GRCm39)	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25,101,193 (GRCm39)	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	25,037,005 (GRCm39)	splice site	probably benign
R2101:Kidins220	UTSW	12	25,107,422 (GRCm39)	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25,091,302 (GRCm39)	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25,107,323 (GRCm39)	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25,061,508 (GRCm39)	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	25,040,757 (GRCm39)	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25,051,564 (GRCm39)	splice site	probably benign
R3915:Kidins220	UTSW	12	25,103,957 (GRCm39)	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25,107,143 (GRCm39)	splice site	probably null
R4287:Kidins220	UTSW	12	25,106,845 (GRCm39)	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25,061,000 (GRCm39)	missense	probably damaging	1.00
R4627:Kidins220	UTSW	12	25,107,041 (GRCm39)	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25,107,284 (GRCm39)	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25,063,442 (GRCm39)	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	25,042,259 (GRCm39)	nonsense	probably null
R5118:Kidins220	UTSW	12	25,042,296 (GRCm39)	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25,101,125 (GRCm39)	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25,053,009 (GRCm39)	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25,097,896 (GRCm39)	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25,063,390 (GRCm39)	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25,107,139 (GRCm39)	nonsense	probably null
R6131:Kidins220	UTSW	12	25,042,313 (GRCm39)	splice site	probably null
R6146:Kidins220	UTSW	12	25,102,812 (GRCm39)	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25,106,908 (GRCm39)	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	25,047,310 (GRCm39)	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25,101,307 (GRCm39)	splice site	probably null
R6289:Kidins220	UTSW	12	25,106,615 (GRCm39)	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25,107,533 (GRCm39)	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25,107,190 (GRCm39)	missense	probably benign
R6513:Kidins220	UTSW	12	25,088,434 (GRCm39)	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25,060,059 (GRCm39)	splice site	probably null
R6711:Kidins220	UTSW	12	25,048,750 (GRCm39)	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25,058,542 (GRCm39)	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25,107,662 (GRCm39)	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25,054,018 (GRCm39)	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	25,044,820 (GRCm39)	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25,086,623 (GRCm39)	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25,061,570 (GRCm39)	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25,106,999 (GRCm39)	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	25,032,360 (GRCm39)	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	25,042,268 (GRCm39)	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	25,038,555 (GRCm39)	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	25,032,350 (GRCm39)	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25,111,230 (GRCm39)	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25,107,715 (GRCm39)	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	25,044,854 (GRCm39)	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25,107,127 (GRCm39)	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25,086,533 (GRCm39)	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	25,040,727 (GRCm39)	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25,090,527 (GRCm39)	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25,051,593 (GRCm39)	missense	probably benign
R8831:Kidins220	UTSW	12	25,086,454 (GRCm39)	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25,106,914 (GRCm39)	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	25,036,966 (GRCm39)	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	25,038,558 (GRCm39)	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25,107,110 (GRCm39)	missense	probably benign	0.36
R9343:Kidins220	UTSW	12	25,058,078 (GRCm39)	missense	probably damaging	1.00
R9526:Kidins220	UTSW	12	25,088,383 (GRCm39)	missense	probably damaging	1.00
R9644:Kidins220	UTSW	12	25,061,018 (GRCm39)	missense	probably damaging	1.00
R9655:Kidins220	UTSW	12	25,047,295 (GRCm39)	missense	probably damaging	1.00
R9664:Kidins220	UTSW	12	25,106,895 (GRCm39)	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CCTCTTTTATGTACATCAATTGGGC -3'
(R):5'- TTACCCTGTTGTAGAAAGGGTG -3'

Sequencing Primer
(F):5'- AACTCAGCTGGAGTCACT -3'
(R):5'- CGACAGGCCGCTGTAGTAG -3'

Posted On

2015-07-21