Incidental Mutation 'R4497:Spag16'
ID331004
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission 041750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4497 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70493830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 556 (D556G)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425]
Predicted Effect probably damaging
Transcript: ENSMUST00000065425
AA Change: D556G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: D556G

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161310
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Adat1 T C 8: 111,979,362 S371G probably benign Het
Aoc3 T G 11: 101,332,045 I369R possibly damaging Het
Apobr A T 7: 126,587,522 probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
Astn2 A G 4: 66,119,063 probably benign Het
Bcas1 T C 2: 170,406,821 D60G probably damaging Het
Cacnb4 T A 2: 52,477,771 D62V probably damaging Het
Cbx8 C A 11: 119,040,792 R20L probably damaging Het
Ccdc92 G A 5: 124,836,273 T64M probably benign Het
Cps1 G T 1: 67,205,199 S1135I probably null Het
Eml2 G A 7: 19,179,350 R91H probably damaging Het
Fbxl3 G A 14: 103,082,877 P426L probably damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Gabrb2 T C 11: 42,597,694 I329T probably benign Het
Gli3 T A 13: 15,723,571 D745E possibly damaging Het
Lacc1 T A 14: 77,034,030 N239I probably damaging Het
Lamb2 T A 9: 108,486,798 C1008S probably damaging Het
Man2b1 G A 8: 85,090,936 V349I probably benign Het
Mib1 A G 18: 10,811,985 T961A possibly damaging Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Olfr156 A G 4: 43,821,175 F62S probably damaging Het
Olfr497 T A 7: 108,422,915 C115S probably benign Het
Pgr A G 9: 8,958,419 E809G probably damaging Het
Ppp1r3g T A 13: 35,969,620 V341E probably benign Het
Prkdc T A 16: 15,700,653 S1091T probably benign Het
Rab44 G A 17: 29,139,897 R353K probably benign Het
Reck G A 4: 43,891,001 M46I probably benign Het
Rorb G T 19: 18,977,628 S208Y possibly damaging Het
Serinc2 G T 4: 130,254,054 T410N possibly damaging Het
Slc23a2 G A 2: 132,056,782 R612* probably null Het
Slx4 T C 16: 3,994,909 E145G probably damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssfa2 T A 2: 79,657,820 V749E probably damaging Het
Tmf1 A T 6: 97,172,332 F485I probably benign Het
Trmo C T 4: 46,382,140 V326M probably damaging Het
Tssk5 T C 15: 76,372,211 D336G probably damaging Het
Ttyh2 A T 11: 114,710,963 Q471L possibly damaging Het
Wdr33 A C 18: 31,893,079 Q944H unknown Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Zbtb18 A T 1: 177,447,121 S7C probably damaging Het
Zfhx4 G A 3: 5,399,620 V1638M possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense not run
R7566:Spag16 UTSW 1 69870328 missense not run
R7570:Spag16 UTSW 1 69996841 missense not run
Predicted Primers PCR Primer
(F):5'- CATGTAAGGCTTCACATCTTAAGG -3'
(R):5'- GCTTGTGATGTCTCTAGGTTAATACC -3'

Sequencing Primer
(F):5'- GGCATTGATAAAACTGGAAC -3'
(R):5'- ATCCTACCTGACTGGTCA -3'
Posted On2015-07-21