Incidental Mutation 'R4511:Lnx1'
ID331161
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Nameligand of numb-protein X 1
Synonyms
MMRRC Submission 041586-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4511 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location74592447-74702912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74620192 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 382 (D382N)
Ref Sequence ENSEMBL: ENSMUSP00000113035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000117388] [ENSMUST00000117525] [ENSMUST00000121690] [ENSMUST00000127396] [ENSMUST00000153543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039744
AA Change: D282N

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228
AA Change: D282N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087161
AA Change: D382N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: D382N

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113531
AA Change: D223N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228
AA Change: D223N

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117388
AA Change: D382N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: D382N

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117525
AA Change: D282N

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113837
Gene: ENSMUSG00000029228
AA Change: D282N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121690
AA Change: D272N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113565
Gene: ENSMUSG00000029228
AA Change: D272N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
PDZ 178 253 5.33e-19 SMART
PDZ 285 358 2.27e-13 SMART
PDZ 407 484 8.27e-16 SMART
PDZ 537 614 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140084
AA Change: D65N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117935
Gene: ENSMUSG00000029228
AA Change: D65N

DomainStartEndE-ValueType
PDZ 1 47 2.73e-1 SMART
PDZ 79 154 1.51e-9 SMART
PDZ 156 233 8.27e-16 SMART
SCOP:d1qaua_ 274 322 3e-7 SMART
Blast:PDZ 286 322 4e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000153543
AA Change: D223N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121094
Gene: ENSMUSG00000029228
AA Change: D223N

DomainStartEndE-ValueType
Blast:PDZ 2 105 9e-37 BLAST
Blast:PDZ 129 159 1e-12 BLAST
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
Atrn G A 2: 130,935,577 W182* probably null Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Cacna1e G A 1: 154,561,833 T257I probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Ddx17 A T 15: 79,538,592 V315E probably damaging Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Fgfr4 C A 13: 55,161,515 P455Q possibly damaging Het
Gabbr1 A G 17: 37,069,211 K697E probably damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mctp1 G A 13: 76,825,272 V431I probably benign Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74685717 missense probably benign 0.00
IGL01538:Lnx1 APN 5 74620155 missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74685759 missense probably benign 0.02
IGL03188:Lnx1 APN 5 74620263 missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74620347 critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74607909 splice site probably benign
R1343:Lnx1 UTSW 5 74597379 missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74620017 missense probably damaging 1.00
R1681:Lnx1 UTSW 5 74685410 missense probably benign
R1714:Lnx1 UTSW 5 74607737 missense probably null 1.00
R1727:Lnx1 UTSW 5 74607916 splice site probably null
R1806:Lnx1 UTSW 5 74606049 missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74620066 missense probably benign 0.25
R2879:Lnx1 UTSW 5 74620123 missense probably benign 0.03
R2984:Lnx1 UTSW 5 74685422 nonsense probably null
R3790:Lnx1 UTSW 5 74628366 splice site probably benign
R3953:Lnx1 UTSW 5 74606089 missense probably benign
R4509:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74685543 missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4624:Lnx1 UTSW 5 74660460 intron probably benign
R4647:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4648:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4877:Lnx1 UTSW 5 74628123 missense probably benign 0.01
R4883:Lnx1 UTSW 5 74607869 missense probably benign
R5256:Lnx1 UTSW 5 74685654 missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74677569 missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74685608 nonsense probably null
R6408:Lnx1 UTSW 5 74685646 missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74607880 missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74677514 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAATCAGATGAGCTGCACTC -3'
(R):5'- AGGCTTACTCTCAAATGGCCC -3'

Sequencing Primer
(F):5'- AATCAGATGAGCTGCACTCTCTGG -3'
(R):5'- TTACTCTCAAATGGCCCCACCC -3'
Posted On2015-07-21