Incidental Mutation 'R0219:Ccna1'
ID33708
Institutional Source Beutler Lab
Gene Symbol Ccna1
Ensembl Gene ENSMUSG00000027793
Gene Namecyclin A1
Synonyms
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0219 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location55045469-55055501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55050927 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 112 (I112V)
Ref Sequence ENSEMBL: ENSMUSP00000143275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029368] [ENSMUST00000197238] [ENSMUST00000198102] [ENSMUST00000198320] [ENSMUST00000199144] [ENSMUST00000199352]
Predicted Effect probably benign
Transcript: ENSMUST00000029368
AA Change: I112V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029368
Gene: ENSMUSG00000027793
AA Change: I112V

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.8e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197238
AA Change: I112V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142692
Gene: ENSMUSG00000027793
AA Change: I112V

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.7e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198102
SMART Domains Protein: ENSMUSP00000142706
Gene: ENSMUSG00000027793

DomainStartEndE-ValueType
CYCLIN 57 141 1.5e-32 SMART
Cyclin_C 150 250 3.6e-10 SMART
CYCLIN 154 238 2.2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198320
AA Change: I112V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143447
Gene: ENSMUSG00000027793
AA Change: I112V

DomainStartEndE-ValueType
CYCLIN 205 289 1.5e-32 SMART
Cyclin_C 298 415 2.7e-39 SMART
CYCLIN 302 384 1.5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199144
AA Change: I112V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000199352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199770
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are infertile due to the arrest of spermatogenesis prior to the first meiotic division. Female mutant mice are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Ccna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccna1 APN 3 55050655 missense probably damaging 1.00
IGL00341:Ccna1 APN 3 55050655 missense probably damaging 1.00
IGL02484:Ccna1 APN 3 55048494 missense probably benign 0.08
IGL02649:Ccna1 APN 3 55054386 missense probably damaging 1.00
IGL03310:Ccna1 APN 3 55050620 missense probably benign 0.01
IGL03382:Ccna1 APN 3 55047277 missense probably damaging 1.00
R0127:Ccna1 UTSW 3 55049748 missense probably damaging 1.00
R0195:Ccna1 UTSW 3 55054364 missense probably damaging 0.99
R0255:Ccna1 UTSW 3 55050628 missense probably damaging 1.00
R0492:Ccna1 UTSW 3 55048583 missense probably damaging 0.98
R1102:Ccna1 UTSW 3 55050860 missense probably damaging 1.00
R1378:Ccna1 UTSW 3 55049729 missense probably damaging 1.00
R3724:Ccna1 UTSW 3 55050932 missense probably damaging 0.99
R3799:Ccna1 UTSW 3 55050619 missense probably benign 0.24
R4199:Ccna1 UTSW 3 55047315 missense possibly damaging 0.85
R4992:Ccna1 UTSW 3 55049890 missense probably damaging 0.97
R5465:Ccna1 UTSW 3 55045644 missense probably benign 0.00
R5560:Ccna1 UTSW 3 55048569 missense probably damaging 1.00
R5603:Ccna1 UTSW 3 55050909 missense probably damaging 1.00
R6764:Ccna1 UTSW 3 55046078 missense probably damaging 1.00
R7034:Ccna1 UTSW 3 55046039 missense possibly damaging 0.67
R7144:Ccna1 UTSW 3 55045699 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCAGCTACTGGACTGGAACAC -3'
(R):5'- AGCTTTCTAAGTGCAGCCCAGCTC -3'

Sequencing Primer
(F):5'- CTGGACTGGAACACGGCAG -3'
(R):5'- GAACTCTTCCCATAGGACAGATGTG -3'
Posted On2013-05-09