Incidental Mutation 'R0316:Cpxm1'
ID34168
Institutional Source Beutler Lab
Gene Symbol Cpxm1
Ensembl Gene ENSMUSG00000027408
Gene Namecarboxypeptidase X 1 (M14 family)
SynonymsCpx-1
MMRRC Submission 038526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0316 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130390775-130397574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130393171 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 576 (E576G)
Ref Sequence ENSEMBL: ENSMUSP00000028897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028897]
Predicted Effect probably damaging
Transcript: ENSMUST00000028897
AA Change: E576G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028897
Gene: ENSMUSG00000027408
AA Change: E576G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
FA58C 104 263 1.44e-28 SMART
Zn_pept 410 699 5.77e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130533
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the carboxypeptidase family of proteins. Cloning of a comparable locus in mouse indicates that the encoded protein contains a discoidin domain and a carboxypeptidase domain, but the protein appears to lack residues necessary for carboxypeptidase activity.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,369 F276I probably damaging Het
Ado A G 10: 67,548,718 L19P possibly damaging Het
Ago2 T C 15: 73,130,876 H169R probably damaging Het
Asic1 G A 15: 99,671,938 A47T probably benign Het
Atg16l2 A T 7: 101,293,396 I364N probably damaging Het
C130050O18Rik G A 5: 139,414,558 R122Q probably damaging Het
Capn7 T A 14: 31,347,809 C197S probably benign Het
Casp16-ps T C 17: 23,552,092 D113G probably damaging Het
Cdh18 T A 15: 23,366,913 V235D probably damaging Het
Clca4a G T 3: 144,953,764 T777K probably damaging Het
Col17a1 A G 19: 47,685,533 probably null Het
Col5a3 C A 9: 20,775,325 D1335Y unknown Het
Dcbld2 T C 16: 58,433,445 S182P probably damaging Het
Dclk1 C T 3: 55,502,892 S616L probably damaging Het
Dgcr14 G A 16: 17,910,094 P103S probably benign Het
Dll4 C A 2: 119,331,153 D405E probably damaging Het
Dnah1 G A 14: 31,278,151 R2462C probably benign Het
Dnah3 A T 7: 119,965,659 Y2594N possibly damaging Het
Fam110a C A 2: 151,970,086 A255S probably benign Het
Fbn2 G A 18: 58,113,325 R502W probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Gm1527 T C 3: 28,915,774 S342P probably damaging Het
Gm19668 A T 10: 77,798,730 probably benign Het
Gm5901 A T 7: 105,377,315 T97S probably damaging Het
Greb1l A G 18: 10,547,420 Y1546C probably damaging Het
Impg1 A T 9: 80,342,065 S619T probably damaging Het
Itih2 C A 2: 10,105,246 Q565H possibly damaging Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lama3 T C 18: 12,519,877 M218T probably benign Het
Lipg T C 18: 74,960,941 S12G probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mex3d G T 10: 80,381,671 P571T probably damaging Het
Neb A C 2: 52,195,470 Y1538D possibly damaging Het
Nsd1 T C 13: 55,213,771 I184T probably damaging Het
Olfr1143 T C 2: 87,803,181 F264S probably damaging Het
Olfr1451 T A 19: 12,999,402 C139S probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pacs1 T C 19: 5,135,121 silent Het
Pdcd11 T C 19: 47,113,172 V932A probably damaging Het
Pkd2 A G 5: 104,477,166 D276G probably damaging Het
Pkia T A 3: 7,437,439 D25E probably damaging Het
Plxna2 A C 1: 194,644,150 S131R probably damaging Het
Prelid1 T C 13: 55,324,407 V132A possibly damaging Het
Psma3 T C 12: 70,983,389 Y59H probably benign Het
Ptchd3 A C 11: 121,842,090 E602A possibly damaging Het
Ptpro T C 6: 137,376,989 V121A possibly damaging Het
Ptprt A G 2: 161,607,319 L878P probably damaging Het
Pxn G A 5: 115,553,968 G370S probably damaging Het
Rcn2 G T 9: 56,042,169 A40S probably benign Het
Rnf215 A G 11: 4,139,760 N258D probably damaging Het
Rnpc3 T C 3: 113,629,973 T28A probably damaging Het
Rtel1 T A 2: 181,356,002 V1100E possibly damaging Het
Scn3a T A 2: 65,460,829 I1858F probably damaging Het
Slc9c1 G A 16: 45,580,232 R735Q possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata13 A G 14: 60,692,339 T449A probably benign Het
Svep1 A G 4: 58,072,737 W2191R probably damaging Het
Thbs1 G A 2: 118,117,574 R405H probably damaging Het
Tnn A G 1: 160,120,567 Y859H possibly damaging Het
Tonsl A G 15: 76,629,300 S1245P possibly damaging Het
Tpcn1 G A 5: 120,539,259 T661M probably damaging Het
Trap1 A G 16: 4,045,560 F533L probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Vax2 T C 6: 83,711,444 S50P possibly damaging Het
Vmn1r5 A C 6: 56,985,799 E153A probably benign Het
Vmn2r14 G T 5: 109,218,896 P486Q probably benign Het
Vmn2r96 T A 17: 18,582,565 F246I probably damaging Het
Zc3h10 C A 10: 128,544,755 E244D probably damaging Het
Zdhhc18 T A 4: 133,613,655 K265* probably null Het
Other mutations in Cpxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cpxm1 APN 2 130395943 missense probably damaging 1.00
IGL01327:Cpxm1 APN 2 130396357 missense probably benign 0.00
IGL01373:Cpxm1 APN 2 130394135 missense probably damaging 1.00
IGL01622:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01623:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01981:Cpxm1 APN 2 130394140 nonsense probably null
IGL02031:Cpxm1 APN 2 130393681 missense probably damaging 1.00
IGL02369:Cpxm1 APN 2 130396424 missense probably damaging 1.00
IGL03057:Cpxm1 APN 2 130393189 missense probably damaging 1.00
R0544:Cpxm1 UTSW 2 130393135 missense probably damaging 1.00
R0726:Cpxm1 UTSW 2 130390939 missense probably damaging 0.96
R0944:Cpxm1 UTSW 2 130397503 missense probably damaging 1.00
R1334:Cpxm1 UTSW 2 130393563 missense probably damaging 0.99
R1366:Cpxm1 UTSW 2 130396122 missense probably damaging 1.00
R1429:Cpxm1 UTSW 2 130396444 missense probably damaging 0.98
R1654:Cpxm1 UTSW 2 130393546 missense possibly damaging 0.51
R1824:Cpxm1 UTSW 2 130395697 missense probably damaging 0.99
R2144:Cpxm1 UTSW 2 130397410 missense probably benign 0.00
R2200:Cpxm1 UTSW 2 130393197 missense probably damaging 1.00
R2320:Cpxm1 UTSW 2 130394211 missense probably damaging 1.00
R2434:Cpxm1 UTSW 2 130394084 missense probably damaging 1.00
R3118:Cpxm1 UTSW 2 130393573 missense possibly damaging 0.80
R4601:Cpxm1 UTSW 2 130393576 missense possibly damaging 0.83
R5020:Cpxm1 UTSW 2 130395977 splice site probably null
R5041:Cpxm1 UTSW 2 130394070 missense probably damaging 1.00
R5727:Cpxm1 UTSW 2 130390963 nonsense probably null
R5806:Cpxm1 UTSW 2 130397473 missense probably damaging 1.00
R6660:Cpxm1 UTSW 2 130396149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCACCCCTTAGCCTCAAGTTG -3'
(R):5'- CACGAATAGGGCCATGCAGGATAC -3'

Sequencing Primer
(F):5'- agaacatctgaaaccaccctac -3'
(R):5'- TGCATGGCAACGTCATCAATG -3'
Posted On2013-05-09