Incidental Mutation 'R0058:Stam'
ID34317
Institutional Source Beutler Lab
Gene Symbol Stam
Ensembl Gene ENSMUSG00000026718
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 1
SynonymsSTAM1
MMRRC Submission 038352-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R0058 (G1)
Quality Score149
Status Validated
Chromosome2
Chromosomal Location14074098-14149634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14138141 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 336 (C336R)
Ref Sequence ENSEMBL: ENSMUSP00000100025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028050] [ENSMUST00000102960] [ENSMUST00000193636]
Predicted Effect probably damaging
Transcript: ENSMUST00000028050
AA Change: C336R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028050
Gene: ENSMUSG00000026718
AA Change: C336R

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
PDB:3F1I|C 301 377 9e-46 PDB
low complexity region 387 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102960
AA Change: C336R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100025
Gene: ENSMUSG00000026718
AA Change: C336R

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
Pfam:GAT 304 377 6.8e-10 PFAM
low complexity region 387 404 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131734
Predicted Effect probably benign
Transcript: ENSMUST00000193636
SMART Domains Protein: ENSMUSP00000141207
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
Pfam:VHS 5 44 2e-8 PFAM
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive growth retardation, priapism, male infertility, degeneration of hippocapal CA3 pyramidal neurons and premature death, but exhibit normal lymphocyte development, proliferation and responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Bpifb1 G A 2: 154,206,540 R165H possibly damaging Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Faf1 A G 4: 109,736,624 Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Golga3 T A 5: 110,202,777 F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Olfr323 A T 11: 58,625,668 I126N probably damaging Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Prrc2c C T 1: 162,698,884 V253I unknown Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Tspear T C 10: 77,869,631 F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Stam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Stam APN 2 14115968 intron probably benign
IGL02964:Stam APN 2 14115968 intron probably benign
IGL03365:Stam APN 2 14146390 nonsense probably null
R0410:Stam UTSW 2 14138991 missense probably benign 0.04
R0479:Stam UTSW 2 14117495 missense probably damaging 1.00
R1018:Stam UTSW 2 14117374 splice site probably benign
R1554:Stam UTSW 2 14141828 missense probably benign
R1631:Stam UTSW 2 14146248 nonsense probably null
R1897:Stam UTSW 2 14129026 missense probably damaging 1.00
R3735:Stam UTSW 2 14129012 missense probably damaging 1.00
R3973:Stam UTSW 2 14138961 missense probably damaging 1.00
R4610:Stam UTSW 2 14115858 missense probably damaging 1.00
R4914:Stam UTSW 2 14102416 missense probably damaging 1.00
R5079:Stam UTSW 2 14074539 missense probably benign
R5209:Stam UTSW 2 14146347 missense probably benign 0.04
R5574:Stam UTSW 2 14115864 missense probably damaging 1.00
R5636:Stam UTSW 2 14117427 missense probably damaging 1.00
R6968:Stam UTSW 2 14116018 missense probably damaging 1.00
Z1088:Stam UTSW 2 14139090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCTACTGCTCCAGGATGGGCT -3'
(R):5'- CCCAAATCCTCACTCAGAGCAAGGTA -3'

Sequencing Primer
(F):5'- gaggcagaggcaggcag -3'
(R):5'- caccatactcttccttctccc -3'
Posted On2013-05-09